ID: 1168158150

View in Genome Browser
Species Human (GRCh38)
Location 19:54489907-54489929
Sequence CGGCAGCTTACCTGGAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168158150_1168158153 -7 Left 1168158150 19:54489907-54489929 CCAGCATTCCAGGTAAGCTGCCG No data
Right 1168158153 19:54489923-54489945 GCTGCCGTCGGCCCTACCTCCGG No data
1168158150_1168158154 -6 Left 1168158150 19:54489907-54489929 CCAGCATTCCAGGTAAGCTGCCG No data
Right 1168158154 19:54489924-54489946 CTGCCGTCGGCCCTACCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168158150 Original CRISPR CGGCAGCTTACCTGGAATGC TGG (reversed) Intergenic
No off target data available for this crispr