ID: 1168158561

View in Genome Browser
Species Human (GRCh38)
Location 19:54492792-54492814
Sequence CCAGGAAGAAAGCATGGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168158561_1168158567 4 Left 1168158561 19:54492792-54492814 CCCTTACCATGCTTTCTTCCTGG No data
Right 1168158567 19:54492819-54492841 TCCCTTGACCAGTCTTGGCATGG No data
1168158561_1168158566 -1 Left 1168158561 19:54492792-54492814 CCCTTACCATGCTTTCTTCCTGG No data
Right 1168158566 19:54492814-54492836 GACTTTCCCTTGACCAGTCTTGG No data
1168158561_1168158570 8 Left 1168158561 19:54492792-54492814 CCCTTACCATGCTTTCTTCCTGG No data
Right 1168158570 19:54492823-54492845 TTGACCAGTCTTGGCATGGCAGG No data
1168158561_1168158572 13 Left 1168158561 19:54492792-54492814 CCCTTACCATGCTTTCTTCCTGG No data
Right 1168158572 19:54492828-54492850 CAGTCTTGGCATGGCAGGCGAGG No data
1168158561_1168158577 28 Left 1168158561 19:54492792-54492814 CCCTTACCATGCTTTCTTCCTGG No data
Right 1168158577 19:54492843-54492865 AGGCGAGGGAATGAGGGATTGGG No data
1168158561_1168158575 22 Left 1168158561 19:54492792-54492814 CCCTTACCATGCTTTCTTCCTGG No data
Right 1168158575 19:54492837-54492859 CATGGCAGGCGAGGGAATGAGGG No data
1168158561_1168158573 14 Left 1168158561 19:54492792-54492814 CCCTTACCATGCTTTCTTCCTGG No data
Right 1168158573 19:54492829-54492851 AGTCTTGGCATGGCAGGCGAGGG No data
1168158561_1168158578 29 Left 1168158561 19:54492792-54492814 CCCTTACCATGCTTTCTTCCTGG No data
Right 1168158578 19:54492844-54492866 GGCGAGGGAATGAGGGATTGGGG No data
1168158561_1168158576 27 Left 1168158561 19:54492792-54492814 CCCTTACCATGCTTTCTTCCTGG No data
Right 1168158576 19:54492842-54492864 CAGGCGAGGGAATGAGGGATTGG No data
1168158561_1168158574 21 Left 1168158561 19:54492792-54492814 CCCTTACCATGCTTTCTTCCTGG No data
Right 1168158574 19:54492836-54492858 GCATGGCAGGCGAGGGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168158561 Original CRISPR CCAGGAAGAAAGCATGGTAA GGG (reversed) Intergenic
No off target data available for this crispr