ID: 1168158564

View in Genome Browser
Species Human (GRCh38)
Location 19:54492798-54492820
Sequence GAAAGTCCAGGAAGAAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168158564_1168158572 7 Left 1168158564 19:54492798-54492820 CCATGCTTTCTTCCTGGACTTTC No data
Right 1168158572 19:54492828-54492850 CAGTCTTGGCATGGCAGGCGAGG No data
1168158564_1168158567 -2 Left 1168158564 19:54492798-54492820 CCATGCTTTCTTCCTGGACTTTC No data
Right 1168158567 19:54492819-54492841 TCCCTTGACCAGTCTTGGCATGG No data
1168158564_1168158579 27 Left 1168158564 19:54492798-54492820 CCATGCTTTCTTCCTGGACTTTC No data
Right 1168158579 19:54492848-54492870 AGGGAATGAGGGATTGGGGCTGG No data
1168158564_1168158575 16 Left 1168158564 19:54492798-54492820 CCATGCTTTCTTCCTGGACTTTC No data
Right 1168158575 19:54492837-54492859 CATGGCAGGCGAGGGAATGAGGG No data
1168158564_1168158580 28 Left 1168158564 19:54492798-54492820 CCATGCTTTCTTCCTGGACTTTC No data
Right 1168158580 19:54492849-54492871 GGGAATGAGGGATTGGGGCTGGG No data
1168158564_1168158576 21 Left 1168158564 19:54492798-54492820 CCATGCTTTCTTCCTGGACTTTC No data
Right 1168158576 19:54492842-54492864 CAGGCGAGGGAATGAGGGATTGG No data
1168158564_1168158578 23 Left 1168158564 19:54492798-54492820 CCATGCTTTCTTCCTGGACTTTC No data
Right 1168158578 19:54492844-54492866 GGCGAGGGAATGAGGGATTGGGG No data
1168158564_1168158577 22 Left 1168158564 19:54492798-54492820 CCATGCTTTCTTCCTGGACTTTC No data
Right 1168158577 19:54492843-54492865 AGGCGAGGGAATGAGGGATTGGG No data
1168158564_1168158570 2 Left 1168158564 19:54492798-54492820 CCATGCTTTCTTCCTGGACTTTC No data
Right 1168158570 19:54492823-54492845 TTGACCAGTCTTGGCATGGCAGG No data
1168158564_1168158573 8 Left 1168158564 19:54492798-54492820 CCATGCTTTCTTCCTGGACTTTC No data
Right 1168158573 19:54492829-54492851 AGTCTTGGCATGGCAGGCGAGGG No data
1168158564_1168158574 15 Left 1168158564 19:54492798-54492820 CCATGCTTTCTTCCTGGACTTTC No data
Right 1168158574 19:54492836-54492858 GCATGGCAGGCGAGGGAATGAGG No data
1168158564_1168158566 -7 Left 1168158564 19:54492798-54492820 CCATGCTTTCTTCCTGGACTTTC No data
Right 1168158566 19:54492814-54492836 GACTTTCCCTTGACCAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168158564 Original CRISPR GAAAGTCCAGGAAGAAAGCA TGG (reversed) Intergenic