ID: 1168158565

View in Genome Browser
Species Human (GRCh38)
Location 19:54492810-54492832
Sequence GACTGGTCAAGGGAAAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168158565_1168158576 9 Left 1168158565 19:54492810-54492832 CCTGGACTTTCCCTTGACCAGTC No data
Right 1168158576 19:54492842-54492864 CAGGCGAGGGAATGAGGGATTGG No data
1168158565_1168158579 15 Left 1168158565 19:54492810-54492832 CCTGGACTTTCCCTTGACCAGTC No data
Right 1168158579 19:54492848-54492870 AGGGAATGAGGGATTGGGGCTGG No data
1168158565_1168158582 22 Left 1168158565 19:54492810-54492832 CCTGGACTTTCCCTTGACCAGTC No data
Right 1168158582 19:54492855-54492877 GAGGGATTGGGGCTGGGAGGCGG No data
1168158565_1168158578 11 Left 1168158565 19:54492810-54492832 CCTGGACTTTCCCTTGACCAGTC No data
Right 1168158578 19:54492844-54492866 GGCGAGGGAATGAGGGATTGGGG No data
1168158565_1168158580 16 Left 1168158565 19:54492810-54492832 CCTGGACTTTCCCTTGACCAGTC No data
Right 1168158580 19:54492849-54492871 GGGAATGAGGGATTGGGGCTGGG No data
1168158565_1168158574 3 Left 1168158565 19:54492810-54492832 CCTGGACTTTCCCTTGACCAGTC No data
Right 1168158574 19:54492836-54492858 GCATGGCAGGCGAGGGAATGAGG No data
1168158565_1168158573 -4 Left 1168158565 19:54492810-54492832 CCTGGACTTTCCCTTGACCAGTC No data
Right 1168158573 19:54492829-54492851 AGTCTTGGCATGGCAGGCGAGGG No data
1168158565_1168158570 -10 Left 1168158565 19:54492810-54492832 CCTGGACTTTCCCTTGACCAGTC No data
Right 1168158570 19:54492823-54492845 TTGACCAGTCTTGGCATGGCAGG No data
1168158565_1168158577 10 Left 1168158565 19:54492810-54492832 CCTGGACTTTCCCTTGACCAGTC No data
Right 1168158577 19:54492843-54492865 AGGCGAGGGAATGAGGGATTGGG No data
1168158565_1168158584 24 Left 1168158565 19:54492810-54492832 CCTGGACTTTCCCTTGACCAGTC No data
Right 1168158584 19:54492857-54492879 GGGATTGGGGCTGGGAGGCGGGG No data
1168158565_1168158583 23 Left 1168158565 19:54492810-54492832 CCTGGACTTTCCCTTGACCAGTC No data
Right 1168158583 19:54492856-54492878 AGGGATTGGGGCTGGGAGGCGGG No data
1168158565_1168158572 -5 Left 1168158565 19:54492810-54492832 CCTGGACTTTCCCTTGACCAGTC No data
Right 1168158572 19:54492828-54492850 CAGTCTTGGCATGGCAGGCGAGG No data
1168158565_1168158575 4 Left 1168158565 19:54492810-54492832 CCTGGACTTTCCCTTGACCAGTC No data
Right 1168158575 19:54492837-54492859 CATGGCAGGCGAGGGAATGAGGG No data
1168158565_1168158581 19 Left 1168158565 19:54492810-54492832 CCTGGACTTTCCCTTGACCAGTC No data
Right 1168158581 19:54492852-54492874 AATGAGGGATTGGGGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168158565 Original CRISPR GACTGGTCAAGGGAAAGTCC AGG (reversed) Intergenic
No off target data available for this crispr