ID: 1168158567

View in Genome Browser
Species Human (GRCh38)
Location 19:54492819-54492841
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168158564_1168158567 -2 Left 1168158564 19:54492798-54492820 CCATGCTTTCTTCCTGGACTTTC No data
Right 1168158567 19:54492819-54492841 TCCCTTGACCAGTCTTGGCATGG No data
1168158561_1168158567 4 Left 1168158561 19:54492792-54492814 CCCTTACCATGCTTTCTTCCTGG No data
Right 1168158567 19:54492819-54492841 TCCCTTGACCAGTCTTGGCATGG No data
1168158563_1168158567 3 Left 1168158563 19:54492793-54492815 CCTTACCATGCTTTCTTCCTGGA No data
Right 1168158567 19:54492819-54492841 TCCCTTGACCAGTCTTGGCATGG No data
1168158560_1168158567 5 Left 1168158560 19:54492791-54492813 CCCCTTACCATGCTTTCTTCCTG No data
Right 1168158567 19:54492819-54492841 TCCCTTGACCAGTCTTGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168158567 Original CRISPR TCCCTTGACCAGTCTTGGCA TGG Intergenic