ID: 1168158568

View in Genome Browser
Species Human (GRCh38)
Location 19:54492820-54492842
Sequence GCCATGCCAAGACTGGTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168158568_1168158577 0 Left 1168158568 19:54492820-54492842 CCCTTGACCAGTCTTGGCATGGC No data
Right 1168158577 19:54492843-54492865 AGGCGAGGGAATGAGGGATTGGG No data
1168158568_1168158576 -1 Left 1168158568 19:54492820-54492842 CCCTTGACCAGTCTTGGCATGGC No data
Right 1168158576 19:54492842-54492864 CAGGCGAGGGAATGAGGGATTGG No data
1168158568_1168158575 -6 Left 1168158568 19:54492820-54492842 CCCTTGACCAGTCTTGGCATGGC No data
Right 1168158575 19:54492837-54492859 CATGGCAGGCGAGGGAATGAGGG No data
1168158568_1168158580 6 Left 1168158568 19:54492820-54492842 CCCTTGACCAGTCTTGGCATGGC No data
Right 1168158580 19:54492849-54492871 GGGAATGAGGGATTGGGGCTGGG No data
1168158568_1168158578 1 Left 1168158568 19:54492820-54492842 CCCTTGACCAGTCTTGGCATGGC No data
Right 1168158578 19:54492844-54492866 GGCGAGGGAATGAGGGATTGGGG No data
1168158568_1168158583 13 Left 1168158568 19:54492820-54492842 CCCTTGACCAGTCTTGGCATGGC No data
Right 1168158583 19:54492856-54492878 AGGGATTGGGGCTGGGAGGCGGG No data
1168158568_1168158584 14 Left 1168158568 19:54492820-54492842 CCCTTGACCAGTCTTGGCATGGC No data
Right 1168158584 19:54492857-54492879 GGGATTGGGGCTGGGAGGCGGGG No data
1168158568_1168158582 12 Left 1168158568 19:54492820-54492842 CCCTTGACCAGTCTTGGCATGGC No data
Right 1168158582 19:54492855-54492877 GAGGGATTGGGGCTGGGAGGCGG No data
1168158568_1168158574 -7 Left 1168158568 19:54492820-54492842 CCCTTGACCAGTCTTGGCATGGC No data
Right 1168158574 19:54492836-54492858 GCATGGCAGGCGAGGGAATGAGG No data
1168158568_1168158581 9 Left 1168158568 19:54492820-54492842 CCCTTGACCAGTCTTGGCATGGC No data
Right 1168158581 19:54492852-54492874 AATGAGGGATTGGGGCTGGGAGG No data
1168158568_1168158579 5 Left 1168158568 19:54492820-54492842 CCCTTGACCAGTCTTGGCATGGC No data
Right 1168158579 19:54492848-54492870 AGGGAATGAGGGATTGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168158568 Original CRISPR GCCATGCCAAGACTGGTCAA GGG (reversed) Intergenic