ID: 1168158571

View in Genome Browser
Species Human (GRCh38)
Location 19:54492827-54492849
Sequence CTCGCCTGCCATGCCAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168158571_1168158581 2 Left 1168158571 19:54492827-54492849 CCAGTCTTGGCATGGCAGGCGAG No data
Right 1168158581 19:54492852-54492874 AATGAGGGATTGGGGCTGGGAGG No data
1168158571_1168158586 27 Left 1168158571 19:54492827-54492849 CCAGTCTTGGCATGGCAGGCGAG No data
Right 1168158586 19:54492877-54492899 GGGAAGACAGCTCTCTCCCTGGG No data
1168158571_1168158584 7 Left 1168158571 19:54492827-54492849 CCAGTCTTGGCATGGCAGGCGAG No data
Right 1168158584 19:54492857-54492879 GGGATTGGGGCTGGGAGGCGGGG No data
1168158571_1168158576 -8 Left 1168158571 19:54492827-54492849 CCAGTCTTGGCATGGCAGGCGAG No data
Right 1168158576 19:54492842-54492864 CAGGCGAGGGAATGAGGGATTGG No data
1168158571_1168158580 -1 Left 1168158571 19:54492827-54492849 CCAGTCTTGGCATGGCAGGCGAG No data
Right 1168158580 19:54492849-54492871 GGGAATGAGGGATTGGGGCTGGG No data
1168158571_1168158583 6 Left 1168158571 19:54492827-54492849 CCAGTCTTGGCATGGCAGGCGAG No data
Right 1168158583 19:54492856-54492878 AGGGATTGGGGCTGGGAGGCGGG No data
1168158571_1168158579 -2 Left 1168158571 19:54492827-54492849 CCAGTCTTGGCATGGCAGGCGAG No data
Right 1168158579 19:54492848-54492870 AGGGAATGAGGGATTGGGGCTGG No data
1168158571_1168158582 5 Left 1168158571 19:54492827-54492849 CCAGTCTTGGCATGGCAGGCGAG No data
Right 1168158582 19:54492855-54492877 GAGGGATTGGGGCTGGGAGGCGG No data
1168158571_1168158585 26 Left 1168158571 19:54492827-54492849 CCAGTCTTGGCATGGCAGGCGAG No data
Right 1168158585 19:54492876-54492898 GGGGAAGACAGCTCTCTCCCTGG No data
1168158571_1168158577 -7 Left 1168158571 19:54492827-54492849 CCAGTCTTGGCATGGCAGGCGAG No data
Right 1168158577 19:54492843-54492865 AGGCGAGGGAATGAGGGATTGGG No data
1168158571_1168158578 -6 Left 1168158571 19:54492827-54492849 CCAGTCTTGGCATGGCAGGCGAG No data
Right 1168158578 19:54492844-54492866 GGCGAGGGAATGAGGGATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168158571 Original CRISPR CTCGCCTGCCATGCCAAGAC TGG (reversed) Intergenic
No off target data available for this crispr