ID: 1168158575

View in Genome Browser
Species Human (GRCh38)
Location 19:54492837-54492859
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168158563_1168158575 21 Left 1168158563 19:54492793-54492815 CCTTACCATGCTTTCTTCCTGGA No data
Right 1168158575 19:54492837-54492859 CATGGCAGGCGAGGGAATGAGGG No data
1168158569_1168158575 -7 Left 1168158569 19:54492821-54492843 CCTTGACCAGTCTTGGCATGGCA No data
Right 1168158575 19:54492837-54492859 CATGGCAGGCGAGGGAATGAGGG No data
1168158561_1168158575 22 Left 1168158561 19:54492792-54492814 CCCTTACCATGCTTTCTTCCTGG No data
Right 1168158575 19:54492837-54492859 CATGGCAGGCGAGGGAATGAGGG No data
1168158565_1168158575 4 Left 1168158565 19:54492810-54492832 CCTGGACTTTCCCTTGACCAGTC No data
Right 1168158575 19:54492837-54492859 CATGGCAGGCGAGGGAATGAGGG No data
1168158568_1168158575 -6 Left 1168158568 19:54492820-54492842 CCCTTGACCAGTCTTGGCATGGC No data
Right 1168158575 19:54492837-54492859 CATGGCAGGCGAGGGAATGAGGG No data
1168158564_1168158575 16 Left 1168158564 19:54492798-54492820 CCATGCTTTCTTCCTGGACTTTC No data
Right 1168158575 19:54492837-54492859 CATGGCAGGCGAGGGAATGAGGG No data
1168158560_1168158575 23 Left 1168158560 19:54492791-54492813 CCCCTTACCATGCTTTCTTCCTG No data
Right 1168158575 19:54492837-54492859 CATGGCAGGCGAGGGAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168158575 Original CRISPR CATGGCAGGCGAGGGAATGA GGG Intergenic