ID: 1168158581

View in Genome Browser
Species Human (GRCh38)
Location 19:54492852-54492874
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168158565_1168158581 19 Left 1168158565 19:54492810-54492832 CCTGGACTTTCCCTTGACCAGTC No data
Right 1168158581 19:54492852-54492874 AATGAGGGATTGGGGCTGGGAGG No data
1168158571_1168158581 2 Left 1168158571 19:54492827-54492849 CCAGTCTTGGCATGGCAGGCGAG No data
Right 1168158581 19:54492852-54492874 AATGAGGGATTGGGGCTGGGAGG No data
1168158569_1168158581 8 Left 1168158569 19:54492821-54492843 CCTTGACCAGTCTTGGCATGGCA No data
Right 1168158581 19:54492852-54492874 AATGAGGGATTGGGGCTGGGAGG No data
1168158568_1168158581 9 Left 1168158568 19:54492820-54492842 CCCTTGACCAGTCTTGGCATGGC No data
Right 1168158581 19:54492852-54492874 AATGAGGGATTGGGGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168158581 Original CRISPR AATGAGGGATTGGGGCTGGG AGG Intergenic