ID: 1168158582

View in Genome Browser
Species Human (GRCh38)
Location 19:54492855-54492877
Sequence GAGGGATTGGGGCTGGGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168158565_1168158582 22 Left 1168158565 19:54492810-54492832 CCTGGACTTTCCCTTGACCAGTC No data
Right 1168158582 19:54492855-54492877 GAGGGATTGGGGCTGGGAGGCGG No data
1168158571_1168158582 5 Left 1168158571 19:54492827-54492849 CCAGTCTTGGCATGGCAGGCGAG No data
Right 1168158582 19:54492855-54492877 GAGGGATTGGGGCTGGGAGGCGG No data
1168158568_1168158582 12 Left 1168158568 19:54492820-54492842 CCCTTGACCAGTCTTGGCATGGC No data
Right 1168158582 19:54492855-54492877 GAGGGATTGGGGCTGGGAGGCGG No data
1168158569_1168158582 11 Left 1168158569 19:54492821-54492843 CCTTGACCAGTCTTGGCATGGCA No data
Right 1168158582 19:54492855-54492877 GAGGGATTGGGGCTGGGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168158582 Original CRISPR GAGGGATTGGGGCTGGGAGG CGG Intergenic
No off target data available for this crispr