ID: 1168158583

View in Genome Browser
Species Human (GRCh38)
Location 19:54492856-54492878
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168158565_1168158583 23 Left 1168158565 19:54492810-54492832 CCTGGACTTTCCCTTGACCAGTC No data
Right 1168158583 19:54492856-54492878 AGGGATTGGGGCTGGGAGGCGGG No data
1168158569_1168158583 12 Left 1168158569 19:54492821-54492843 CCTTGACCAGTCTTGGCATGGCA No data
Right 1168158583 19:54492856-54492878 AGGGATTGGGGCTGGGAGGCGGG No data
1168158568_1168158583 13 Left 1168158568 19:54492820-54492842 CCCTTGACCAGTCTTGGCATGGC No data
Right 1168158583 19:54492856-54492878 AGGGATTGGGGCTGGGAGGCGGG No data
1168158571_1168158583 6 Left 1168158571 19:54492827-54492849 CCAGTCTTGGCATGGCAGGCGAG No data
Right 1168158583 19:54492856-54492878 AGGGATTGGGGCTGGGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168158583 Original CRISPR AGGGATTGGGGCTGGGAGGC GGG Intergenic