ID: 1168158585

View in Genome Browser
Species Human (GRCh38)
Location 19:54492876-54492898
Sequence GGGGAAGACAGCTCTCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168158571_1168158585 26 Left 1168158571 19:54492827-54492849 CCAGTCTTGGCATGGCAGGCGAG No data
Right 1168158585 19:54492876-54492898 GGGGAAGACAGCTCTCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168158585 Original CRISPR GGGGAAGACAGCTCTCTCCC TGG Intergenic
No off target data available for this crispr