ID: 1168158586

View in Genome Browser
Species Human (GRCh38)
Location 19:54492877-54492899
Sequence GGGAAGACAGCTCTCTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168158571_1168158586 27 Left 1168158571 19:54492827-54492849 CCAGTCTTGGCATGGCAGGCGAG No data
Right 1168158586 19:54492877-54492899 GGGAAGACAGCTCTCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168158586 Original CRISPR GGGAAGACAGCTCTCTCCCT GGG Intergenic
No off target data available for this crispr