ID: 1168160002

View in Genome Browser
Species Human (GRCh38)
Location 19:54503778-54503800
Sequence CCCACCCAGCACTGCCTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 1, 2: 4, 3: 39, 4: 276}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168160002_1168160008 4 Left 1168160002 19:54503778-54503800 CCCCAAAGGCAGTGCTGGGTGGG 0: 1
1: 1
2: 4
3: 39
4: 276
Right 1168160008 19:54503805-54503827 ATGTTGATTCTTAGAGGGCCTGG 0: 2
1: 0
2: 0
3: 6
4: 109
1168160002_1168160006 -2 Left 1168160002 19:54503778-54503800 CCCCAAAGGCAGTGCTGGGTGGG 0: 1
1: 1
2: 4
3: 39
4: 276
Right 1168160006 19:54503799-54503821 GGAGTGATGTTGATTCTTAGAGG 0: 2
1: 0
2: 0
3: 8
4: 135
1168160002_1168160007 -1 Left 1168160002 19:54503778-54503800 CCCCAAAGGCAGTGCTGGGTGGG 0: 1
1: 1
2: 4
3: 39
4: 276
Right 1168160007 19:54503800-54503822 GAGTGATGTTGATTCTTAGAGGG 0: 2
1: 0
2: 0
3: 12
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168160002 Original CRISPR CCCACCCAGCACTGCCTTTG GGG (reversed) Intronic
900213469 1:1468572-1468594 CCCTCCCACCCCTGCCTTTGCGG + Exonic
900221031 1:1509393-1509415 CCCTCCCACCCCTGCCTTTGCGG + Intergenic
900283777 1:1890023-1890045 CGCTCCCACCGCTGCCTTTGTGG - Intronic
900799475 1:4728446-4728468 CCCACCCAGCCCCGGGTTTGGGG + Intronic
901880800 1:12192683-12192705 CCCACCCAGTCCTGCCTTCCAGG - Intronic
902614465 1:17616280-17616302 CCCACCCAGCATGACCTCTGGGG - Intronic
902777963 1:18686576-18686598 CCCAACCAGCAGGGCCTCTGTGG + Intronic
902839459 1:19066033-19066055 TCCACCCAGCCCTGGCTTCGGGG + Intergenic
903478716 1:23637980-23638002 CCCACCCAGCTCTGTCTCTGTGG + Intronic
904058226 1:27686246-27686268 GCCACCCAACACTGTCTTGGTGG - Intergenic
904400624 1:30254207-30254229 CCCACCTGGCCCTGCCCTTGTGG - Intergenic
905183299 1:36179327-36179349 CACGCCCAGCACTGCCCTTCGGG - Intronic
906545093 1:46614867-46614889 CCCATCCTGGCCTGCCTTTGTGG - Intronic
907043913 1:51288056-51288078 CCTGCCCTGCCCTGCCTTTGGGG - Exonic
912128594 1:106572023-106572045 CCCATCCACCAATGCCTTTGGGG + Intergenic
913538287 1:119795239-119795261 CCACTCCAGCACTGCTTTTGAGG + Intronic
915604775 1:156943679-156943701 CCCATCCAGCACTGTGCTTGGGG + Intronic
915667510 1:157458474-157458496 TCCACACAGCATTGCCTCTGTGG - Intergenic
916838994 1:168580190-168580212 CCCACCCAGCACAACTTCTGAGG - Intronic
918258773 1:182774895-182774917 ACTCCCCAGCACTGCTTTTGGGG + Intergenic
918879294 1:190094805-190094827 CCCACCCCGCCCTGTCTTTGTGG - Intergenic
920972968 1:210758278-210758300 GCCACTCAGTTCTGCCTTTGGGG - Intronic
1063008963 10:2003863-2003885 CCCTCACAGCCCTGCCATTGCGG - Intergenic
1065166279 10:22981716-22981738 CTCACCCAGCACTGACTTGTGGG + Intronic
1067233001 10:44425193-44425215 CGCATCCACCACTGCCTTGGTGG + Intergenic
1067836094 10:49642697-49642719 CCCACTCCACACTGGCTTTGGGG + Intronic
1070017721 10:72550707-72550729 CCCTCTGAGCACTGCTTTTGTGG + Intronic
1070669648 10:78369048-78369070 CCCACACTGCACTCACTTTGGGG - Intergenic
1073473950 10:103740842-103740864 TCCACCCAGCACTGTCTTGATGG + Intronic
1074709732 10:116167296-116167318 CCCACCCAGCATTGCAGGTGGGG + Intronic
1075093854 10:119458492-119458514 CCCTCCGAGCAATGCCTTTCAGG - Intronic
1075622777 10:123939933-123939955 CCTACCCAGCTCTGCCTGTGTGG - Intronic
1075807960 10:125203617-125203639 CCCTCCCAGAACTCCCTTTGGGG + Intergenic
1076007024 10:126956025-126956047 CCATCCCAGCACAGCCTTGGAGG - Intronic
1076020961 10:127072761-127072783 TCCTCCCAGCACTGCCATGGTGG + Intronic
1077317526 11:1926024-1926046 GGCTACCAGCACTGCCTTTGTGG + Intronic
1077325596 11:1962642-1962664 CCCACCCAGCTCAGCCTGTCAGG + Intronic
1077339467 11:2019599-2019621 CCCACCCTGCTCTGGCTTGGTGG - Intergenic
1083191070 11:61052819-61052841 CCCACCCAGACCTGCCTCTCTGG + Intergenic
1084030240 11:66476659-66476681 CCCACCCACCACTCACTTGGGGG - Exonic
1084652661 11:70498352-70498374 CCCACCCTGCACTGCCGCTTTGG - Intronic
1085698902 11:78729080-78729102 TCCACCTGGCCCTGCCTTTGTGG + Intronic
1085818868 11:79770858-79770880 TCCTCCCAGCACTGCCCTAGTGG - Intergenic
1088437476 11:109831360-109831382 CCAACACAGCTTTGCCTTTGGGG - Intergenic
1202808576 11_KI270721v1_random:17821-17843 CCCACCCAGCTCAGCCTGTCAGG + Intergenic
1202822452 11_KI270721v1_random:74788-74810 CCCACCCTGCTCTGGCTTGGTGG - Intergenic
1091545770 12:1500515-1500537 CTCCCCGAGCACAGCCTTTGTGG + Intergenic
1091820236 12:3470655-3470677 GGCACACAGCACTGCCTCTGTGG + Intronic
1097766495 12:63532818-63532840 CACACACACCCCTGCCTTTGGGG + Intergenic
1102025063 12:109709747-109709769 CTCACCCACCTCTGCTTTTGGGG + Intergenic
1102048521 12:109845437-109845459 GCCTCCCAGCTCTGCCTCTGCGG + Intergenic
1102172361 12:110852066-110852088 CCCACACATCACATCCTTTGAGG - Intronic
1102772285 12:115488573-115488595 CCCAAGCATCACTGCCATTGTGG - Intergenic
1103573973 12:121863277-121863299 CCCAGCCAGCTCTGCATTTCTGG + Intronic
1105294637 13:19076875-19076897 CCCACCCACCAGTGTCTCTGTGG - Intergenic
1105754646 13:23453216-23453238 CCCACCCAGGAATGCCCCTGTGG + Intergenic
1106414073 13:29531362-29531384 CTCTGACAGCACTGCCTTTGAGG + Intronic
1106848497 13:33763353-33763375 CTCACAGAGCACTGCATTTGTGG + Intergenic
1107041110 13:35948609-35948631 CCCACACATCATTGCATTTGGGG - Intronic
1107722917 13:43267622-43267644 TCCACTGACCACTGCCTTTGAGG - Intronic
1109246156 13:59956639-59956661 TCCACCCAGCAGTGCCCTAGTGG - Intronic
1110488551 13:76074648-76074670 CCCTCTTAGCACTGCCTTTATGG - Intergenic
1110737784 13:78958255-78958277 GCCACCCAGCACTGACTCAGCGG - Intergenic
1111248946 13:85578282-85578304 CCCACTCAACTCTGCTTTTGTGG + Intergenic
1111395367 13:87661246-87661268 CCCACCCAGTACTGCTTTCTGGG + Intergenic
1112370831 13:98792002-98792024 CCCTCACAACACTGCTTTTGAGG - Intergenic
1114269065 14:21090548-21090570 CCCCCCCAGCCCTGCCTCTCCGG + Exonic
1117452830 14:55867665-55867687 TTCACCCAGCACTGCCTCAGAGG + Intergenic
1117815175 14:59590428-59590450 CCCAGCCAAAACTGCCTTCGTGG + Intergenic
1119694537 14:76702195-76702217 TGCAGCCAGCACTGCCTTCGTGG + Intergenic
1119705348 14:76779647-76779669 CCCACACAGCACTGCCCATGGGG - Exonic
1119716549 14:76863621-76863643 CCCACACAGCCCTGCCCTGGAGG - Intronic
1121278692 14:92685250-92685272 GCCGCCCAGCCCTGCCTTAGGGG + Intronic
1121324231 14:93010555-93010577 CCCACCTGGCCCTGCCTTTTAGG + Intronic
1121684038 14:95818807-95818829 CCCAGCCAGCACTCCCTGAGAGG - Intergenic
1122058142 14:99119087-99119109 CCTGCCCAGCACTGGCGTTGGGG - Intergenic
1122203755 14:100138029-100138051 CCCCCCCTGCACTACCTCTGTGG - Intronic
1122235035 14:100326529-100326551 TCCACCCAACACTGCCTTCAAGG - Intronic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1122816122 14:104314912-104314934 CCTGCCCAGCCCTGCCTCTGGGG + Intergenic
1122898225 14:104770995-104771017 CCCTCCCAGAGCTGCCTCTGTGG - Intronic
1122956281 14:105073041-105073063 TCCACCCAGGCCTGCCTGTGGGG - Intergenic
1124883809 15:33665546-33665568 CCCACCCAACACTGTCCTCGTGG + Intronic
1125519208 15:40338926-40338948 CCTGCCCAGCACTGCCCATGTGG - Intronic
1125717298 15:41826646-41826668 GGTGCCCAGCACTGCCTTTGAGG - Exonic
1129942827 15:79513000-79513022 CCCACCTCACACTGCCTTGGAGG + Intergenic
1132568267 16:632988-633010 CCCAACCTGCACCGCCTGTGGGG - Exonic
1132598050 16:762132-762154 CCCACCCAGCAGCGTCTTTTTGG - Intronic
1132755456 16:1482323-1482345 TCCACCCCACTCTGCCTTTGAGG - Intergenic
1132801908 16:1758686-1758708 CCCACCCAGCCCAGAATTTGGGG + Intronic
1132873517 16:2125831-2125853 CCCACCCTTCACAGCCTGTGTGG + Intronic
1133011165 16:2912420-2912442 CCCGCCCAGCGCTGCCTTCCTGG + Intronic
1133320945 16:4913528-4913550 ATCACCCAGCTCTGCCTCTGTGG + Intronic
1133712150 16:8411682-8411704 CCCACCCACCACAGGCTCTGTGG + Intergenic
1134100802 16:11450050-11450072 GCCACCCAGCCCTGCCTCAGAGG + Intronic
1134205317 16:12232884-12232906 CCCACCCAGCATGGGCTTGGAGG + Intronic
1134410655 16:14000854-14000876 CCAACCCAGCTCTGCCACTGAGG + Intergenic
1134819882 16:17238440-17238462 ACCACTCAGCTCTGCCCTTGAGG + Intronic
1135630739 16:24034183-24034205 CCCACCCACCACTGTCTCTGAGG - Intronic
1135669351 16:24361885-24361907 CACGCCCAGCACAGCCTTGGGGG + Exonic
1136409146 16:30066227-30066249 CCCACCCCTCACTGCCTCTTAGG - Intronic
1137317486 16:47341490-47341512 GCCCCCAAGTACTGCCTTTGTGG - Intronic
1138098465 16:54232181-54232203 CCCATCCATCCCTGCCTTGGAGG - Intergenic
1138465192 16:57185413-57185435 CCCATCCTGCACTGCCATTCTGG + Intronic
1138477699 16:57281882-57281904 CCCTACCTGCAGTGCCTTTGAGG - Intronic
1143770353 17:9164576-9164598 CCAACCCAGCCCTGCTTATGTGG + Intronic
1144201957 17:12949569-12949591 ACCAGCCAGCACTGCCTATGTGG - Intronic
1148336650 17:46846601-46846623 CCCACCCAGCCATGCTTCTGTGG - Intronic
1148610430 17:48961158-48961180 CCCACCCAGCGCTGCCTGCCTGG + Intronic
1149867376 17:60158177-60158199 CACACCCACCCCTTCCTTTGTGG - Intronic
1151562559 17:74878339-74878361 CCCACCCATCACTGAGCTTGTGG - Exonic
1152327841 17:79651864-79651886 ACCCCCCATCACTGGCTTTGAGG + Intergenic
1154009473 18:10562871-10562893 CCTTCACATCACTGCCTTTGAGG - Intergenic
1154333440 18:13448274-13448296 CACACTCAGCACTGCTCTTGTGG + Intronic
1156487724 18:37477240-37477262 AGCACCCAGCACTGCCCTTGGGG - Intronic
1157294987 18:46435822-46435844 CCCACCCAGCACTGCCTTGCTGG - Intronic
1157497427 18:48166489-48166511 CCCTCCCAGGAATGCCGTTGGGG + Intronic
1157812999 18:50711000-50711022 CCCACCCAGCACGGGCTTGCTGG + Intronic
1159502126 18:69286788-69286810 CCCTCCCAGCACTGCCATGTTGG + Intergenic
1160155623 18:76431957-76431979 CCCGCCCACCACTGCCCTGGCGG + Intronic
1160237627 18:77098730-77098752 CCCACTCTGCCCTGCCTTGGCGG - Intronic
1160417441 18:78721101-78721123 CACGCCCAGCACTGCCTGTGGGG + Intergenic
1160514631 18:79471621-79471643 CACAGCCAGCCCTGCCTCTGTGG + Intronic
1161078065 19:2296095-2296117 CCCTCCCAGCACTGTTTTTCTGG + Intronic
1161126401 19:2560450-2560472 CCCACCCAGCCCTTCCCTTGAGG + Intronic
1161842877 19:6693440-6693462 ACAACCCAGCTCTGCCTTTGCGG - Exonic
1162156789 19:8683992-8684014 CCCTGCCAGCCCTGGCTTTGTGG + Intergenic
1162918168 19:13885333-13885355 GCCACCCAGCGCTGGCTTCGAGG + Intronic
1163422156 19:17219856-17219878 CCCATCTAGCAGTGCCTTTCAGG + Intergenic
1163783823 19:19264280-19264302 CCCACCTATCACTGCCATCGTGG - Intergenic
1164462939 19:28464173-28464195 CCCTTCCAGCTCTGCCTTTGAGG - Intergenic
1165433754 19:35786063-35786085 CCCACCCAGCCGTGCCTCTGGGG + Intronic
1166068557 19:40374613-40374635 CACACCCAGCAGTACCTGTGAGG - Exonic
1166218534 19:41351740-41351762 CCCACCCAGCACTTCCCCTGCGG + Intronic
1167374100 19:49102021-49102043 CCCACCCATCCCTGCCCATGTGG - Intronic
1167374499 19:49103678-49103700 CCCACCCAGCCCTGGCCTAGGGG - Intronic
1168137928 19:54364230-54364252 CCCACCCAGCACTGCCCTTGGGG + Intronic
1168153458 19:54460963-54460985 AGCCCCCAGCGCTGCCTTTGCGG + Exonic
1168160002 19:54503778-54503800 CCCACCCAGCACTGCCTTTGGGG - Intronic
925719638 2:6814401-6814423 CCCACCCTGCTCTTCCTCTGTGG - Intergenic
925919711 2:8630654-8630676 CCCACCCGGCTCTGCCCTGGTGG + Intergenic
928202206 2:29255163-29255185 TCCCACCAGCACTGCCTCTGGGG + Intronic
928768889 2:34681606-34681628 CCCACCCACCAGAGCCTTAGTGG + Intergenic
932924708 2:75959548-75959570 CTCAGCAAGCACTGCCATTGTGG + Intergenic
933521618 2:83381371-83381393 CCCAGGCAGCACTGCCTCTGTGG - Intergenic
933646846 2:84820055-84820077 CCCACCAACCTCTGCTTTTGAGG - Intergenic
933786516 2:85847192-85847214 CCCAGCCAGCACTGCCTTCCAGG + Intronic
935146598 2:100399676-100399698 CCCACCCAGCTCTTCCTTTATGG + Intronic
936075504 2:109399042-109399064 CCGCCCCAGAACTGCCTTTTGGG + Intronic
937127807 2:119485378-119485400 CCCACCCAGACCTGCCTCTGGGG - Intronic
938067095 2:128287164-128287186 CCTTCCCATCAGTGCCTTTGTGG - Intronic
942261678 2:174171789-174171811 CCCAACCACTACTGCCTTCGGGG + Intronic
945326322 2:208486705-208486727 CCTTCCCACCACTGCCTATGTGG - Intronic
947716136 2:232339744-232339766 CCTGCCCAGCAGTGCCTTTTGGG + Intronic
948081307 2:235207431-235207453 CACACCCAGCCCTGCCTTCATGG + Intergenic
948278932 2:236731599-236731621 ACTACCCAGCACTGCCATTGTGG - Intergenic
948443525 2:238013729-238013751 CCCACTCCTCACTACCTTTGAGG - Intronic
948554255 2:238796394-238796416 CCTGCCCAGCACTGCCTGTGTGG + Intergenic
1168750514 20:278484-278506 GCCACCCAGCACTTCCTCAGAGG + Intronic
1169417352 20:5428878-5428900 TCCTCCCAGCACAGCTTTTGTGG - Intergenic
1170016869 20:11791498-11791520 CTCACCCAGAACTGCCTGAGGGG - Intergenic
1170418437 20:16168966-16168988 CCCAGCCAGCAGAGCCTCTGTGG - Intergenic
1170573359 20:17645153-17645175 CCCACCCAGCAGTGCAGTAGGGG - Intronic
1171132394 20:22665752-22665774 CCCACCCAGCAAAGCCATAGAGG - Intergenic
1171156638 20:22880557-22880579 CCCACCCAACCATGCCTGTGTGG + Intergenic
1171364777 20:24616408-24616430 TCCTCCCAGCTCTGCCTTTGGGG + Intronic
1171879216 20:30604219-30604241 CCCACCCACCAGTGTCTCTGTGG - Intergenic
1172528659 20:35616353-35616375 CCCGCCCAGCACCGCCCTTTAGG - Intronic
1172695793 20:36822093-36822115 CCCACACAGCCCTGCCATTCTGG + Intronic
1174320656 20:49739237-49739259 TCCACTCGGCACTGCCCTTGTGG + Intergenic
1175307054 20:57983231-57983253 CTCACTCTGCCCTGCCTTTGAGG + Intergenic
1175527446 20:59645276-59645298 TTAACCCAGCCCTGCCTTTGGGG - Intronic
1175790670 20:61738130-61738152 CACCTCCAGCACTGGCTTTGGGG + Intronic
1175880979 20:62258945-62258967 CCACCCCAGCACTGCCTTTATGG + Intronic
1176042412 20:63072452-63072474 CGTCCCCAGCACTGCCCTTGCGG - Intergenic
1176546173 21:8201210-8201232 CCCCCCCACCACCGCCTTGGTGG + Intergenic
1176565124 21:8384256-8384278 CCCCCCCACCACCGCCTTGGTGG + Intergenic
1179291466 21:40021528-40021550 TGCACCCATCACTGCCTTTCTGG + Intronic
1179881600 21:44295382-44295404 CAGACCCAGCCCTGCCCTTGGGG + Intronic
1179885693 21:44313387-44313409 CCAGCCCAGGACTTCCTTTGGGG - Intronic
1180609728 22:17087332-17087354 CTCACCCAGTCCTGCCTTTGTGG - Intronic
1181011518 22:20043620-20043642 CCCACCCAGCACTGTCTGCGTGG + Intronic
1181274919 22:21682251-21682273 CCCAGCCAGCTCCGCCTCTGTGG + Intronic
1182748328 22:32622615-32622637 CCCTCCCAGCTCTGACTTTCTGG - Intronic
1182818508 22:33190671-33190693 CCCACCAAGATCTGCATTTGTGG - Intronic
1182970849 22:34575085-34575107 CCCTCCAAGAACTGCTTTTGAGG + Intergenic
1183060666 22:35334635-35334657 CCCACCCAGCATGGCCTGTGGGG - Intronic
1183314258 22:37128413-37128435 CCCCCCAAGCACTGCCCCTGGGG - Exonic
1183340588 22:37278566-37278588 CACTCCCTGCACTTCCTTTGAGG - Intergenic
1183494980 22:38138055-38138077 CCCACCCAGGATGGCCTGTGTGG + Intronic
1184231351 22:43159926-43159948 CCCTCCCAGCACGTCCTTTCCGG - Intronic
1184247130 22:43241432-43241454 CCCCTCCAGCTCTGCCATTGAGG - Intronic
1184512252 22:44940576-44940598 CCCACCCAGCACTGTTTCTCTGG - Intronic
1184644435 22:45888593-45888615 CCCACCAAGCACTTCCATTCTGG + Intergenic
1184834280 22:47011984-47012006 CCCACCCCGCTCTGCCTTGGTGG + Intronic
1184975883 22:48061613-48061635 CCCTCCCAGCTCTGGCTTTCTGG - Intergenic
1185060580 22:48604453-48604475 CCCGCCCAGCAGGGACTTTGTGG + Intronic
1203251045 22_KI270733v1_random:117447-117469 CCCCCCCACCACCGCCTTGGTGG + Intergenic
950137024 3:10588672-10588694 CCCACTCAGCACTTCCTCTGGGG + Intronic
951030450 3:17875829-17875851 CCCAGCCAGCTCAGCCTTTAGGG - Intronic
952232143 3:31443175-31443197 CACTACAAGCACTGCCTTTGGGG - Intergenic
952842703 3:37661801-37661823 CCCACCTAGCACTCACTGTGTGG - Intronic
952956800 3:38562615-38562637 CGCACCCAGCACCGTCTTAGTGG - Intronic
953549518 3:43890586-43890608 CCCAAGCAGCACAGACTTTGTGG + Intergenic
953996455 3:47523585-47523607 TCCACTCAGCTCAGCCTTTGGGG + Intergenic
954752264 3:52820253-52820275 ACCACCCAGCACAGCCTTTGAGG + Intronic
954973221 3:54669248-54669270 CCAACCCAGGACTGACTATGTGG - Intronic
957723260 3:84031879-84031901 CCCACCCCCAACTGCCATTGCGG + Intergenic
958664231 3:97113608-97113630 GCCACCCAGTTCTCCCTTTGGGG - Intronic
959119164 3:102212205-102212227 CCCACACAGCACTCCCACTGGGG - Intronic
960051233 3:113241271-113241293 CCCAACCATCAGGGCCTTTGGGG - Intronic
960672974 3:120169788-120169810 TCCTCCCTGCTCTGCCTTTGAGG - Intronic
961448356 3:126991560-126991582 CCCACCCAGGCCTGACCTTGCGG - Exonic
962316660 3:134363640-134363662 GCCCCCCAGCACTGCCCTTCTGG - Intronic
965058189 3:163749113-163749135 CCCACCCAGGAGTGGCTCTGAGG + Intergenic
965474636 3:169140149-169140171 CCTACCCTGCTCTGCCTTTCAGG + Intronic
965916724 3:173857405-173857427 CCCTCCCAGGTCTACCTTTGAGG + Intronic
968082539 3:195856746-195856768 CCCAGGCAGCACTGTGTTTGGGG - Intergenic
968445500 4:650229-650251 CCCACCCAGCACTGGATGTTTGG + Intronic
968916604 4:3499542-3499564 CCCACCCAGCCGGGCCTGTGGGG + Intronic
969397099 4:6929129-6929151 ACCACCCAGCACTCCCTCTCAGG - Intronic
969670655 4:8588267-8588289 CTCCCCCAGCACTGCTGTTGGGG - Intronic
973145731 4:46823165-46823187 CCCACCCAGCAGAACCTTGGAGG - Intronic
977995285 4:103493174-103493196 TCCACCCAGCATTGCCCTTATGG - Intergenic
978479930 4:109177358-109177380 CCCACTCATCACTGCATTTGGGG + Intronic
979662873 4:123278604-123278626 CCCTCTCAACACTGCCTTAGCGG + Intronic
982225913 4:153166447-153166469 TCCTTCCAGCACTGCCTTTTGGG - Intronic
985630813 5:1013104-1013126 TCCACCCAGCTCTGCATTTGGGG + Intronic
985984826 5:3506140-3506162 CCCACCCAGCACTGGTATCGTGG - Intergenic
988573164 5:32392027-32392049 CCCAGCCAGCAGTGCTTTTTAGG + Intronic
988707868 5:33743262-33743284 CCCACCCTGGACTGCCTCCGAGG - Intronic
990341478 5:54827370-54827392 CACTCCCATCTCTGCCTTTGTGG - Intergenic
992246653 5:74831604-74831626 CCCAACAAGCATTTCCTTTGAGG + Intronic
992760858 5:79949968-79949990 CCCACCCAACACTGTTTCTGAGG - Intergenic
992952061 5:81868977-81868999 CTCACCCAGCACTCACTTGGTGG + Intergenic
997878661 5:137570973-137570995 CATACCCACCACTGCCTTAGGGG - Intronic
997897776 5:137735403-137735425 CAAACCCAGACCTGCCTTTGCGG + Intronic
998041494 5:138953513-138953535 CCCACCCTGTACTTCCTTTCTGG - Intronic
998535787 5:142929685-142929707 CCCACCCTTCACAGCCTCTGAGG + Intronic
999858210 5:155618051-155618073 CCCACTTATCACTGCCTTAGTGG + Intergenic
1000287084 5:159836186-159836208 ACCACTGAGCACTGCCTTTCTGG - Intergenic
1001735410 5:173994457-173994479 CCCACCCACCAACTCCTTTGTGG - Intronic
1002309638 5:178306687-178306709 AGCACCCAGTACTGCCTTTCCGG - Intronic
1002319427 5:178366151-178366173 CAGACCCAGCCCTGCCCTTGGGG - Intronic
1002420926 5:179148765-179148787 CCCTCCCAGACCTGCCTTTGTGG + Intronic
1003940689 6:11022344-11022366 ACCACCCAGCCCTGCATGTGTGG - Intronic
1004036060 6:11925214-11925236 CCCTCTGACCACTGCCTTTGAGG - Intergenic
1004423577 6:15492601-15492623 CCCAGCCAGCACCACCATTGTGG - Intronic
1006699779 6:35962607-35962629 ACCAGCCAGCACAGCCTGTGGGG + Exonic
1006921768 6:37632287-37632309 CCAACCAAACACTGCCTTTGTGG - Exonic
1007357593 6:41332663-41332685 CCCACCCTGAACTTCCTGTGAGG + Intergenic
1012446999 6:99316677-99316699 CTTACCCAGAAATGCCTTTGGGG - Intronic
1013233183 6:108175167-108175189 CCCCCCAAGCGCTGCCTGTGTGG - Intronic
1013415051 6:109917540-109917562 GCCACCCACCCCTGCCTTGGTGG + Intergenic
1018923175 6:168189732-168189754 CTGGGCCAGCACTGCCTTTGAGG + Intergenic
1019288246 7:234398-234420 ACCCCCCACCACTGCCTGTGAGG - Intronic
1019328448 7:451115-451137 CCCACCCGACACTGCCTCAGAGG + Intergenic
1019485132 7:1285835-1285857 CCCCCCCAGCCCTGCCTTCCTGG + Intergenic
1019685490 7:2379722-2379744 CTCACCCAGCACTGCCTGAAAGG - Intronic
1020096970 7:5374690-5374712 CACCCCCAGCGCTGCCTTTTGGG - Intronic
1021078385 7:16333538-16333560 CCCACCAAGCACTGCTTTTGTGG - Intronic
1022023754 7:26426545-26426567 CTCACCATGCACTGCCTTTATGG + Intergenic
1022322421 7:29299379-29299401 CCCAGACAGCACTGCCTATGGGG - Intronic
1023246492 7:38210467-38210489 CTCACCGAGCCCTGCATTTGAGG - Intronic
1023800094 7:43826606-43826628 CGGTCCCAGCACTGCCTGTGTGG + Intergenic
1023984461 7:45086805-45086827 CCTGCCCACCACTGCCCTTGTGG - Intronic
1024334856 7:48196710-48196732 CCCACTGAGCACTGTCTGTGGGG + Intronic
1025981827 7:66413345-66413367 CCGACCCAGCACTGTTTCTGTGG - Intronic
1026976759 7:74503409-74503431 CCATCCCAGCTCTGCCTTTTGGG + Intronic
1027183632 7:75956587-75956609 CTCACCTAGCACTGCCCCTGAGG + Intronic
1028528045 7:91807341-91807363 CACATCAAGCACTGTCTTTGTGG + Intronic
1029709100 7:102289854-102289876 CCCACCCCACCCTGCCTTTCTGG - Intronic
1029713680 7:102314159-102314181 CCCACCCTACACTGGCTCTGTGG - Intronic
1030686309 7:112490453-112490475 CCCACCCATCACTGTCCCTGGGG - Exonic
1031020708 7:116624874-116624896 CCTCCCCAACACTGCCTTTCAGG - Intergenic
1032000907 7:128264846-128264868 CCCAGCCACCACCCCCTTTGAGG - Intergenic
1032075599 7:128834358-128834380 TCCACCCATCACCTCCTTTGAGG - Intronic
1032787320 7:135211297-135211319 TCCCCCCAGCACTGCCTCCGGGG - Intronic
1034179452 7:149126299-149126321 CCCGGCCGGCTCTGCCTTTGGGG - Exonic
1034670141 7:152851627-152851649 CCCAGCCAGCACTGCCCTCCAGG - Intronic
1035439213 7:158881982-158882004 TCCACCCAGAAATGCCTTTCTGG + Intronic
1035574813 8:697655-697677 CCCACCCCGCACAGTCCTTGTGG + Intronic
1035584782 8:763646-763668 CTCAGCCAGCACTGCCTCTCTGG - Intergenic
1037834735 8:22209313-22209335 CCCACCCATCACTGGCCTCGTGG + Intronic
1037910249 8:22739882-22739904 TCCCCCCAGCCCAGCCTTTGTGG - Intronic
1038077886 8:24098058-24098080 TCCACCCAGTACAGGCTTTGGGG + Intergenic
1039441782 8:37600084-37600106 CCCACCAAGCAAGGCCTTTCTGG + Intergenic
1040286009 8:46100751-46100773 CCCACCCAGGACAGCCCTGGGGG + Intergenic
1040286140 8:46101389-46101411 CCCACCCGGAACAGCCCTTGCGG + Intergenic
1040304895 8:46206907-46206929 CCCACCCAGGACAGCCTTAGTGG - Intergenic
1040315044 8:46256540-46256562 CCCACCCAGGACAGCCCTGGGGG - Intergenic
1040315264 8:46257631-46257653 CCCTACCAGGACAGCCTTTGTGG - Intergenic
1040331009 8:46385754-46385776 CCCACCCAGGACAGCCTTTGGGG - Intergenic
1040342118 8:46446347-46446369 CCCACCCCGGACAGCCTTGGGGG + Intergenic
1040546979 8:48406208-48406230 GACTCCCAGCCCTGCCTTTGTGG + Intergenic
1041025263 8:53679062-53679084 CCCTCTGAGCACTGCTTTTGCGG - Intergenic
1042872879 8:73414044-73414066 CATACCCAACACTGCTTTTGTGG + Intergenic
1043486901 8:80706621-80706643 CCCAGGCCCCACTGCCTTTGTGG - Intronic
1045354873 8:101376651-101376673 ACCAGCCACCACTGCCCTTGTGG - Intergenic
1045604804 8:103760479-103760501 CTCACCCAGCACTGCCATGGTGG - Intronic
1046756303 8:117976244-117976266 ACCGCCCAGCAATTCCTTTGAGG + Intronic
1047964743 8:130038322-130038344 TCAACACAGCACTGCCTATGTGG - Intergenic
1048377454 8:133835025-133835047 GCCACCCAGGGCTGGCTTTGTGG - Intergenic
1049436185 8:142587304-142587326 TCCACCCAGCCCTGCCCTTGGGG + Intergenic
1049439914 8:142604589-142604611 CCCACCCAGCTCCGGCTATGGGG - Intergenic
1051193588 9:14539040-14539062 CACACCCCACACTGCCTATGGGG - Intergenic
1057265193 9:93612819-93612841 CCCACCCACCAGTGTCTCTGTGG + Intronic
1058829555 9:108803301-108803323 CCAAAACAACACTGCCTTTGTGG + Intergenic
1060085807 9:120700274-120700296 ACCATCCAGCCCTGCCTTTGCGG + Intronic
1061483537 9:130908925-130908947 CCACCCCAACCCTGCCTTTGGGG + Intronic
1062439946 9:136565225-136565247 CCAACCCAGGACTGCGCTTGCGG - Intergenic
1062609397 9:137367208-137367230 CCTGCCCAGCAGTGCCTTGGGGG + Intronic
1203467450 Un_GL000220v1:100714-100736 CCCCCCCACCACCGCCTTGGTGG + Intergenic
1185513626 X:681380-681402 CCCACCCAGGGCTGGCTTCGTGG - Intergenic
1191595179 X:62935916-62935938 CCCACCCCCCATTGCCCTTGGGG - Intergenic
1192250702 X:69411209-69411231 CCCACCCAGCCCTGGCTCTTGGG + Intergenic
1192510561 X:71718381-71718403 GCCAACCAGCACGCCCTTTGTGG + Intergenic
1192516136 X:71763172-71763194 GCCAACCAGCACGCCCTTTGTGG - Intergenic
1192667468 X:73102570-73102592 TCCACCCTACACTGCCTCTGTGG + Intergenic
1200234954 X:154463751-154463773 CACACCCAGCCGTGCCCTTGCGG + Intronic
1201868206 Y:18677501-18677523 CACTGCGAGCACTGCCTTTGGGG + Intergenic