ID: 1168163034

View in Genome Browser
Species Human (GRCh38)
Location 19:54525150-54525172
Sequence AAGGATGAACATAATGCGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168163030_1168163034 6 Left 1168163030 19:54525121-54525143 CCTATTCCAGGCAGTCAGAAGGA No data
Right 1168163034 19:54525150-54525172 AAGGATGAACATAATGCGTTGGG No data
1168163026_1168163034 30 Left 1168163026 19:54525097-54525119 CCTGTCATGGTCACTGTCATTGT No data
Right 1168163034 19:54525150-54525172 AAGGATGAACATAATGCGTTGGG No data
1168163028_1168163034 7 Left 1168163028 19:54525120-54525142 CCCTATTCCAGGCAGTCAGAAGG No data
Right 1168163034 19:54525150-54525172 AAGGATGAACATAATGCGTTGGG No data
1168163031_1168163034 0 Left 1168163031 19:54525127-54525149 CCAGGCAGTCAGAAGGAAAAATG No data
Right 1168163034 19:54525150-54525172 AAGGATGAACATAATGCGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168163034 Original CRISPR AAGGATGAACATAATGCGTT GGG Intergenic
No off target data available for this crispr