ID: 1168163505

View in Genome Browser
Species Human (GRCh38)
Location 19:54529281-54529303
Sequence TCTTATCTTCAATTGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168163505_1168163512 23 Left 1168163505 19:54529281-54529303 CCCTCCACCAATTGAAGATAAGA No data
Right 1168163512 19:54529327-54529349 CCTACTTCACGTTAGTATTGAGG No data
1168163505_1168163509 -5 Left 1168163505 19:54529281-54529303 CCCTCCACCAATTGAAGATAAGA No data
Right 1168163509 19:54529299-54529321 TAAGAGATGACCAGAATTCAAGG No data
1168163505_1168163513 27 Left 1168163505 19:54529281-54529303 CCCTCCACCAATTGAAGATAAGA No data
Right 1168163513 19:54529331-54529353 CTTCACGTTAGTATTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168163505 Original CRISPR TCTTATCTTCAATTGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr