ID: 1168163509

View in Genome Browser
Species Human (GRCh38)
Location 19:54529299-54529321
Sequence TAAGAGATGACCAGAATTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168163505_1168163509 -5 Left 1168163505 19:54529281-54529303 CCCTCCACCAATTGAAGATAAGA No data
Right 1168163509 19:54529299-54529321 TAAGAGATGACCAGAATTCAAGG No data
1168163507_1168163509 -9 Left 1168163507 19:54529285-54529307 CCACCAATTGAAGATAAGAGATG No data
Right 1168163509 19:54529299-54529321 TAAGAGATGACCAGAATTCAAGG No data
1168163506_1168163509 -6 Left 1168163506 19:54529282-54529304 CCTCCACCAATTGAAGATAAGAG No data
Right 1168163509 19:54529299-54529321 TAAGAGATGACCAGAATTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168163509 Original CRISPR TAAGAGATGACCAGAATTCA AGG Intergenic
No off target data available for this crispr