ID: 1168163513

View in Genome Browser
Species Human (GRCh38)
Location 19:54529331-54529353
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168163507_1168163513 23 Left 1168163507 19:54529285-54529307 CCACCAATTGAAGATAAGAGATG No data
Right 1168163513 19:54529331-54529353 CTTCACGTTAGTATTGAGGAAGG No data
1168163506_1168163513 26 Left 1168163506 19:54529282-54529304 CCTCCACCAATTGAAGATAAGAG No data
Right 1168163513 19:54529331-54529353 CTTCACGTTAGTATTGAGGAAGG No data
1168163508_1168163513 20 Left 1168163508 19:54529288-54529310 CCAATTGAAGATAAGAGATGACC No data
Right 1168163513 19:54529331-54529353 CTTCACGTTAGTATTGAGGAAGG No data
1168163505_1168163513 27 Left 1168163505 19:54529281-54529303 CCCTCCACCAATTGAAGATAAGA No data
Right 1168163513 19:54529331-54529353 CTTCACGTTAGTATTGAGGAAGG No data
1168163510_1168163513 -1 Left 1168163510 19:54529309-54529331 CCAGAATTCAAGGTGCTGCCTAC No data
Right 1168163513 19:54529331-54529353 CTTCACGTTAGTATTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168163513 Original CRISPR CTTCACGTTAGTATTGAGGA AGG Intergenic
No off target data available for this crispr