ID: 1168165671

View in Genome Browser
Species Human (GRCh38)
Location 19:54545799-54545821
Sequence CCTTCTTGGCGGGGGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168165671_1168165689 30 Left 1168165671 19:54545799-54545821 CCACCCACCCCCCGCCAAGAAGG No data
Right 1168165689 19:54545852-54545874 CCCCCTCCACGACCTTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168165671 Original CRISPR CCTTCTTGGCGGGGGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr