ID: 1168169014

View in Genome Browser
Species Human (GRCh38)
Location 19:54574161-54574183
Sequence GGGGCCACCCCCGTGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 2, 1: 2, 2: 0, 3: 21, 4: 131}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168169001_1168169014 14 Left 1168169001 19:54574124-54574146 CCAGCTGTCCCAGGTCCCTCCTC 0: 4
1: 6
2: 8
3: 50
4: 478
Right 1168169014 19:54574161-54574183 GGGGCCACCCCCGTGCAGCTGGG 0: 2
1: 2
2: 0
3: 21
4: 131
1168169000_1168169014 15 Left 1168169000 19:54574123-54574145 CCCAGCTGTCCCAGGTCCCTCCT 0: 4
1: 7
2: 4
3: 41
4: 491
Right 1168169014 19:54574161-54574183 GGGGCCACCCCCGTGCAGCTGGG 0: 2
1: 2
2: 0
3: 21
4: 131
1168169007_1168169014 -2 Left 1168169007 19:54574140-54574162 CCTCCTCCTCACTAGGGACAAGG 0: 1
1: 3
2: 3
3: 22
4: 179
Right 1168169014 19:54574161-54574183 GGGGCCACCCCCGTGCAGCTGGG 0: 2
1: 2
2: 0
3: 21
4: 131
1168169002_1168169014 6 Left 1168169002 19:54574132-54574154 CCCAGGTCCCTCCTCCTCACTAG 0: 1
1: 3
2: 6
3: 30
4: 283
Right 1168169014 19:54574161-54574183 GGGGCCACCCCCGTGCAGCTGGG 0: 2
1: 2
2: 0
3: 21
4: 131
1168169006_1168169014 -1 Left 1168169006 19:54574139-54574161 CCCTCCTCCTCACTAGGGACAAG 0: 1
1: 3
2: 2
3: 12
4: 178
Right 1168169014 19:54574161-54574183 GGGGCCACCCCCGTGCAGCTGGG 0: 2
1: 2
2: 0
3: 21
4: 131
1168169003_1168169014 5 Left 1168169003 19:54574133-54574155 CCAGGTCCCTCCTCCTCACTAGG 0: 1
1: 4
2: 7
3: 38
4: 332
Right 1168169014 19:54574161-54574183 GGGGCCACCCCCGTGCAGCTGGG 0: 2
1: 2
2: 0
3: 21
4: 131
1168169012_1168169014 -8 Left 1168169012 19:54574146-54574168 CCTCACTAGGGACAAGGGGCCAC 0: 1
1: 3
2: 0
3: 13
4: 110
Right 1168169014 19:54574161-54574183 GGGGCCACCCCCGTGCAGCTGGG 0: 2
1: 2
2: 0
3: 21
4: 131
1168169011_1168169014 -5 Left 1168169011 19:54574143-54574165 CCTCCTCACTAGGGACAAGGGGC 0: 1
1: 3
2: 2
3: 13
4: 109
Right 1168169014 19:54574161-54574183 GGGGCCACCCCCGTGCAGCTGGG 0: 2
1: 2
2: 0
3: 21
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168169014 Original CRISPR GGGGCCACCCCCGTGCAGCT GGG Intronic
900539350 1:3195069-3195091 GGAGCCAGCACCGGGCAGCTCGG + Intronic
900991369 1:6099853-6099875 AGTGACGCCCCCGTGCAGCTTGG + Exonic
901327776 1:8379273-8379295 GGGCCCAGCCCCATGGAGCTGGG - Intronic
901628798 1:10638494-10638516 GGGGCCTCCCTCATGCAGCTAGG - Exonic
905257486 1:36694352-36694374 AGGGCCAGCCCCATGCAGCTAGG - Intergenic
905979536 1:42211184-42211206 GGGGCCTCTCCCATGGAGCTTGG + Intronic
911064221 1:93773424-93773446 TGGGACACCCCTGTGCAGGTGGG + Intronic
912716797 1:111989278-111989300 GGAGCCACCTCCGGGCAGCCAGG - Intergenic
915586199 1:156845266-156845288 GGCGGCACCGCCGGGCAGCTGGG - Exonic
916074614 1:161193280-161193302 GGGGCCACGCCTGTGTAGCGAGG + Exonic
916606103 1:166343471-166343493 GGGGCTCCCACAGTGCAGCTGGG + Intergenic
920011913 1:202874118-202874140 GGTGACACCCCCGTGTACCTGGG + Intergenic
922767999 1:228165986-228166008 GGGGCCACGCACGCGCAGCAGGG - Exonic
923123655 1:231017109-231017131 GGGGCCTCTCCCTTGCTGCTGGG - Intergenic
1063970962 10:11380988-11381010 GGGGTCTCCCCCGTGGAGTTGGG - Intergenic
1067228929 10:44393501-44393523 GGGGCCTCACCCCTGCAGCCAGG - Intergenic
1067288840 10:44926999-44927021 GAGGCCACCCCCAGGCAGCCAGG + Intronic
1069636056 10:69925688-69925710 GGGTCCACCCATGTGCAGCTAGG + Intronic
1069848608 10:71390545-71390567 GAGGCCACCCCTCTGCAGCGTGG - Intergenic
1069986949 10:72291039-72291061 TGGGCCAGACCTGTGCAGCTTGG - Intergenic
1076035423 10:127195821-127195843 CGGGACACCCCGGTGCAGCCGGG - Intronic
1076441867 10:130485734-130485756 GGTGCCACCCCATTGCAGCCTGG - Intergenic
1077303078 11:1856054-1856076 GTGGGCACCCCCGGGCAGCTGGG - Intronic
1077367602 11:2167413-2167435 GGTGAGACCTCCGTGCAGCTAGG - Exonic
1080887192 11:36377473-36377495 GGGGCCCCGCCCGGGCAGCTGGG + Intronic
1083951405 11:65958613-65958635 GGGCCGAGCCCTGTGCAGCTGGG - Intronic
1084171692 11:67404126-67404148 GGGGCCACTCCCGGCCAGCCTGG - Intronic
1084434556 11:69131314-69131336 CGGGCCACCCCTGGGCAGCTCGG - Intergenic
1085348277 11:75781998-75782020 GGGCCAGCCCCCATGCAGCTTGG - Intronic
1085703173 11:78763332-78763354 GGGGCCACTCGAGTGCAGCATGG - Intronic
1088585540 11:111357494-111357516 GGCCCCACCACCGTGTAGCTGGG + Exonic
1091238533 11:134037294-134037316 GGGCCCTCCCCCGTGGAACTGGG + Intergenic
1091451778 12:576536-576558 GGGGCCACCACCCCGCAGCCTGG - Intronic
1092042770 12:5399792-5399814 AGGGCCACCCCAGCCCAGCTGGG - Intergenic
1093529249 12:20141264-20141286 GGGGCTAGCCACGAGCAGCTGGG - Intergenic
1098449919 12:70609018-70609040 GGGCCCAACCCCGTGTGGCTTGG + Intronic
1104207742 12:126656623-126656645 GGGGCCACTGCCCTCCAGCTTGG - Intergenic
1105508805 13:21034328-21034350 GTGGCCACCCCAATGCAACTGGG - Intronic
1106556154 13:30810302-30810324 GGGGCCAGCCTCCTTCAGCTGGG - Intergenic
1107302133 13:38976852-38976874 GGTTCCACACCCATGCAGCTGGG - Intronic
1114268443 14:21087113-21087135 GGGGCCACCCCCCAGCACCCTGG - Intronic
1116821687 14:49633796-49633818 GGGGTCACCGCCGGGCAGCGTGG - Exonic
1122981571 14:105194526-105194548 GGGGCCAGCGCTGGGCAGCTGGG - Intergenic
1123763011 15:23446969-23446991 GGGTCCCCCCCAGTGCCGCTGGG - Intronic
1125892960 15:43279677-43279699 GGTACCACCCCCATGCAGCAGGG + Exonic
1128163718 15:65442138-65442160 AGCTCCACCCCCGAGCAGCTGGG - Intergenic
1130411736 15:83653864-83653886 GGGGCCAGGCCCGGGCCGCTCGG - Intergenic
1131912526 15:97224168-97224190 GGGGCTCCCACAGTGCAGCTGGG - Intergenic
1132724756 16:1333856-1333878 GAGGCCACCCCCGTGCCTCCTGG - Intronic
1135745776 16:25015177-25015199 GGTGCGACCCCCGTGCTGCCCGG + Intronic
1137564277 16:49523612-49523634 GTGGGCACCCACCTGCAGCTCGG + Exonic
1141696658 16:85623491-85623513 GGGCCCACCCCCGTTCCCCTTGG + Intronic
1142748967 17:1976236-1976258 GGGGCCAGCCCCCTGCCCCTGGG - Intronic
1143528278 17:7484760-7484782 GGGGCCACCCCCGTGCATGGCGG - Exonic
1146768110 17:35542477-35542499 GGGGCCACTACACTGCAGCTTGG - Intergenic
1147213801 17:38887476-38887498 GGGGTCGTCCCCGTGCAGCCAGG - Intronic
1148456614 17:47814647-47814669 TGGGCCTCCCCCGGGCAGCTGGG + Intronic
1152584456 17:81182785-81182807 GGGGCCGCCCCCGGCCAGATGGG + Intergenic
1158699534 18:59733885-59733907 AAGGCCACCCCTGTGCAACTGGG + Intergenic
1160239467 18:77112704-77112726 GTGGCCACCCACGTGCTCCTAGG - Intronic
1160403598 18:78629314-78629336 GGGGACACCAAGGTGCAGCTGGG + Intergenic
1160428449 18:78794281-78794303 GGAGCCACACCCGTGTAGCAGGG + Intergenic
1160691918 19:464151-464173 CGGCCCACCACCGTGTAGCTGGG + Exonic
1160730666 19:640391-640413 GGGGCCACCCATCTGCAGGTGGG + Intronic
1160921422 19:1522778-1522800 GGGGCCACCGGGTTGCAGCTGGG - Intergenic
1160989355 19:1854182-1854204 GGGGCCCCCCCAGGGCAGCTAGG - Exonic
1161032178 19:2062544-2062566 GGGGCCACCCCCATTCTTCTAGG - Intergenic
1161234453 19:3190925-3190947 AGGGCCACCCACGTTCAGCTGGG - Intronic
1161611174 19:5243853-5243875 GGGGCCCCGGCCGTGCGGCTTGG - Intronic
1162789587 19:13055915-13055937 GGGGTCACCTCCGTGGGGCTGGG - Intronic
1162909594 19:13842047-13842069 GGGACCAGCCCTGTGCAGCTTGG - Intergenic
1163267887 19:16232668-16232690 GGGGCGGTCCCCGTGCACCTGGG - Intronic
1163725272 19:18919811-18919833 CAGCCCACGCCCGTGCAGCTCGG + Exonic
1164922911 19:32102970-32102992 GGGACGACCCCCCTGCTGCTTGG - Intergenic
1165871446 19:38975909-38975931 GGGGCCAGCCCCGCGCCCCTAGG + Exonic
1166730437 19:45056336-45056358 GGTGCAACCCCAGTGCACCTTGG - Intronic
1167432282 19:49461615-49461637 AGGGCCACCACGGTGCAGCCTGG - Exonic
1168116252 19:54222676-54222698 GGGGCCACCCATGGGCAGCTGGG - Intronic
1168122022 19:54256889-54256911 GGGCCCAACCCCGGGCAGCTGGG - Intronic
1168125465 19:54280192-54280214 GGGGCCACCTCCGTGCAGCTGGG - Intronic
1168130068 19:54312263-54312285 AGGGCCACCCATGGGCAGCTGGG - Intronic
1168134093 19:54338794-54338816 GGGACCACCCCTGGGCAGCTGGG - Intronic
1168169014 19:54574161-54574183 GGGGCCACCCCCGTGCAGCTGGG + Intronic
1168171789 19:54594526-54594548 GGGGCCACCCCCGTGCAGCTGGG + Intronic
1168173701 19:54607955-54607977 GGTCCCACCCCCGGGCAGCTGGG + Intronic
1168176510 19:54631356-54631378 GGGGCCACCCCCGTGCCGCTGGG + Intronic
1168181104 19:54663616-54663638 GGGGCCACCCATGGGCAGCTGGG + Intronic
1168417229 19:56176498-56176520 GCTCTCACCCCCGTGCAGCTGGG - Intronic
1168689509 19:58368343-58368365 GGGGCCACGCCGGTGGCGCTCGG + Exonic
926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG + Intergenic
936038294 2:109129529-109129551 GGCGCCTCCCCCATGCTGCTCGG + Exonic
936069524 2:109356350-109356372 GGTGCCACCACACTGCAGCTAGG + Intronic
937222040 2:120347291-120347313 GGGGACAGCCCCGTGCCTCTCGG + Intronic
937338735 2:121077501-121077523 GGGGCCACCCTCGAGCGGCAGGG - Intergenic
946865747 2:224039561-224039583 CGGGAGACCCACGTGCAGCTGGG - Intergenic
948084600 2:235236837-235236859 GGAGCCAGCCCCGTGCAGTGTGG - Intergenic
948902535 2:240963779-240963801 GCGGCCACCCAGGAGCAGCTGGG + Intronic
1171342306 20:24439982-24440004 GGAGCCACCACCGTGCAGTGAGG - Intergenic
1175845386 20:62055683-62055705 GGGGTCAGCCACATGCAGCTGGG - Intronic
1181509189 22:23381448-23381470 GGGGCCACCCCCAGGCAGGGAGG - Intergenic
1182299634 22:29330367-29330389 GGGGCTCTCACCGTGCAGCTGGG + Exonic
1183450661 22:37893122-37893144 GGGGCCATCTCCCAGCAGCTTGG + Intergenic
1185086569 22:48744103-48744125 GAGGCCACCCCCGTGCCGTGGGG - Intronic
950215258 3:11154400-11154422 GGGCCCACCCGCGAGCAGCGGGG - Intronic
950578906 3:13850345-13850367 GGGACCAGCCCCTGGCAGCTGGG - Intronic
954034620 3:47844606-47844628 GGGGCCAACCCCCTGCCTCTGGG - Intronic
955500131 3:59575120-59575142 GGGGCCACCCCCACTGAGCTGGG - Intergenic
956779340 3:72591890-72591912 AGGCCCACCCACATGCAGCTGGG - Intergenic
958627702 3:96646831-96646853 GGGGCCCCCACAGTGCAGCAGGG + Intergenic
961143540 3:124575326-124575348 TGGGCCACCTCCCTGCAGCTGGG - Intronic
962398516 3:135038131-135038153 GAGGCTACCCCAGTGGAGCTTGG - Intronic
968573270 4:1353511-1353533 GGGGCCTCCCCTGGGGAGCTAGG + Intronic
968757956 4:2426569-2426591 GCGGCCACCTCCCTGCAGGTAGG + Exonic
971079704 4:23195572-23195594 GGACCCACCCCCCTGCATCTAGG - Intergenic
985807081 5:2053772-2053794 GGGCCCACCCCTGTGCAGCAAGG - Intergenic
985872143 5:2565391-2565413 GAGGCAGCCCCCGGGCAGCTTGG - Intergenic
994293783 5:98064297-98064319 GAGGACACCCCCGGGCAGCTAGG + Intergenic
997657196 5:135564177-135564199 GGGGCCACCCCAGAGCTGCCTGG + Intergenic
999264408 5:150256957-150256979 GGGGACACCCCCGTGACCCTGGG - Intronic
999644271 5:153702393-153702415 GGGGCCACCCCTGTGAAACAAGG + Intronic
1004186168 6:13423067-13423089 AGAGACACCCCCTTGCAGCTGGG + Intronic
1006153176 6:32000247-32000269 GGGGCCAGCCCCCATCAGCTGGG + Intronic
1006159484 6:32032984-32033006 GGGGCCAGCCCCCATCAGCTGGG + Intronic
1019233015 6:170584547-170584569 GGGGCCAGGCCTGTGGAGCTGGG - Exonic
1019362147 7:610346-610368 GGGGCCACGCCCAGGCACCTGGG - Intronic
1019486667 7:1292631-1292653 GGGGCCACCACAGGGCAGATGGG + Intergenic
1019492759 7:1322794-1322816 GGGGCCACCTCCTGCCAGCTGGG + Intergenic
1019775817 7:2911610-2911632 GGAGCCAGCCCCCGGCAGCTGGG + Intronic
1021361837 7:19724301-19724323 GGGGGCACCACCGGGCAGCTGGG + Intronic
1028594018 7:92528635-92528657 GGTGCCGCCCCCGAGCGGCTCGG - Intergenic
1034188915 7:149198726-149198748 GGGGCCTCCCCCTTGCTGCCCGG - Exonic
1034196277 7:149250522-149250544 GGGGCCTCCCCCTTGCTGCCCGG - Exonic
1034198614 7:149266704-149266726 GGGGCCTCCCCCTTGCTGCCCGG - Exonic
1034201901 7:149287890-149287912 GGGGCCTCCCCCTTGCTGCCCGG - Intronic
1034273341 7:149813693-149813715 GGGGCCATCTGCGTGCAGCCGGG + Intergenic
1034761194 7:153673433-153673455 TGGGCCAGCCCCGTGAGGCTCGG + Intergenic
1034999162 7:155597656-155597678 GGGGCCAACCCCAGACAGCTTGG - Intergenic
1036396789 8:8377249-8377271 GGGGTCACCCCTGGGCAGCCAGG + Exonic
1038442663 8:27582870-27582892 TTGGCCTCCCCCGTGTAGCTGGG + Intergenic
1045231439 8:100310292-100310314 GGGGCCACCCGGGTGCAGCGGGG - Intronic
1046359515 8:113131860-113131882 GGAGCCAACCCCTTGCATCTAGG + Intronic
1046870215 8:119197410-119197432 GGCTCCACCCCCATGGAGCTAGG - Intronic
1047951650 8:129940027-129940049 GTGGCCACCCCCTTGCACCCCGG + Intronic
1049805718 8:144537917-144537939 GGGGCTCACCCTGTGCAGCTGGG + Intronic
1054602127 9:67137917-67137939 GGGACCACACCCGCACAGCTGGG + Intergenic
1056711443 9:88994903-88994925 TGGGCCAAGCCTGTGCAGCTGGG + Exonic
1057083977 9:92191995-92192017 GGGGCCAGGCCAGAGCAGCTGGG - Intergenic
1058720433 9:107759190-107759212 GGGGCCACCTCTGCACAGCTAGG - Intergenic
1060848193 9:126853872-126853894 TGGGCCTCCCTTGTGCAGCTGGG + Intergenic
1060992498 9:127857012-127857034 GGGGTCACCACCCTCCAGCTGGG - Intergenic
1062023241 9:134328991-134329013 GCGGCCAGCCCCGGGCAGCAGGG - Intronic
1185820914 X:3203645-3203667 GGGGCCACTGCACTGCAGCTTGG - Intergenic
1186534117 X:10329552-10329574 GGGGCCTCCCAGGTGCAGGTGGG + Intergenic
1187910935 X:24110683-24110705 TGTGCCACCCACGTCCAGCTAGG + Intergenic
1194067296 X:89277186-89277208 GGGGCCACCCCTATGGAGCAGGG + Intergenic
1200748448 Y:6923009-6923031 GGGGCCCCCACAGTGCAGCAGGG + Intronic