ID: 1168169658

View in Genome Browser
Species Human (GRCh38)
Location 19:54576921-54576943
Sequence GCTTTGGGGCAGTCACATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 143}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168169658_1168169667 1 Left 1168169658 19:54576921-54576943 CCTGGATGTGACTGCCCCAAAGC 0: 1
1: 0
2: 1
3: 15
4: 143
Right 1168169667 19:54576945-54576967 CCTTCATTTCTGACCTTCTGGGG 0: 1
1: 1
2: 2
3: 36
4: 271
1168169658_1168169668 8 Left 1168169658 19:54576921-54576943 CCTGGATGTGACTGCCCCAAAGC 0: 1
1: 0
2: 1
3: 15
4: 143
Right 1168169668 19:54576952-54576974 TTCTGACCTTCTGGGGCATCTGG 0: 2
1: 0
2: 1
3: 18
4: 187
1168169658_1168169671 15 Left 1168169658 19:54576921-54576943 CCTGGATGTGACTGCCCCAAAGC 0: 1
1: 0
2: 1
3: 15
4: 143
Right 1168169671 19:54576959-54576981 CTTCTGGGGCATCTGGGATGTGG 0: 1
1: 1
2: 2
3: 29
4: 309
1168169658_1168169665 0 Left 1168169658 19:54576921-54576943 CCTGGATGTGACTGCCCCAAAGC 0: 1
1: 0
2: 1
3: 15
4: 143
Right 1168169665 19:54576944-54576966 CCCTTCATTTCTGACCTTCTGGG 0: 1
1: 1
2: 1
3: 47
4: 394
1168169658_1168169663 -1 Left 1168169658 19:54576921-54576943 CCTGGATGTGACTGCCCCAAAGC 0: 1
1: 0
2: 1
3: 15
4: 143
Right 1168169663 19:54576943-54576965 CCCCTTCATTTCTGACCTTCTGG 0: 1
1: 1
2: 2
3: 28
4: 326
1168169658_1168169669 9 Left 1168169658 19:54576921-54576943 CCTGGATGTGACTGCCCCAAAGC 0: 1
1: 0
2: 1
3: 15
4: 143
Right 1168169669 19:54576953-54576975 TCTGACCTTCTGGGGCATCTGGG 0: 2
1: 0
2: 1
3: 20
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168169658 Original CRISPR GCTTTGGGGCAGTCACATCC AGG (reversed) Intronic
900293698 1:1937619-1937641 ACTGGGGGGCAGTCACAGCCGGG - Intronic
900294428 1:1941859-1941881 GCTGGGGGGCAGTCACAGCTGGG - Intronic
901027316 1:6285439-6285461 GCCTGGGGGCAGTCACGTGCTGG + Intronic
901772900 1:11539735-11539757 GGTTTGGGGCAGGCAGGTCCAGG + Intergenic
902367384 1:15985702-15985724 GCTTCCGGGAAGTCACATCATGG + Intergenic
902370533 1:16004222-16004244 GCAGTGGGGGAGCCACATCCTGG + Exonic
904407950 1:30305885-30305907 GTTTTGGGGCACTCAAACCCTGG - Intergenic
905569201 1:38991021-38991043 GCTTTGGGGCTGTCGCGCCCGGG - Intergenic
906227368 1:44132948-44132970 CCTCTGGGGCAGACAGATCCTGG - Intronic
907736219 1:57115197-57115219 GCTTCGGGGCAGACAGATGCAGG + Intronic
909440285 1:75689106-75689128 GCTCTGAGGCAGTACCATCCAGG - Intergenic
909681696 1:78298869-78298891 GCTTTGGGGCAGAGAATTCCAGG - Intergenic
910870332 1:91827526-91827548 CCTTTGGGGCTGTCACATCACGG - Intronic
912456780 1:109803398-109803420 CCTGTGGGGCAGCCACAGCCTGG + Intergenic
917794455 1:178522398-178522420 ACTTTGGGGCAGGCACAGCGTGG - Exonic
920837644 1:209526457-209526479 GTCTTGGGGCAGGCACATCTTGG - Intergenic
923344611 1:233039302-233039324 CCTTGGGGTCAGTCACATCTAGG + Intronic
923475908 1:234330803-234330825 GCCTTGGGACAGTCAAATCTGGG - Intergenic
1064302046 10:14131565-14131587 GAGTTGGGGCAGTCACATCATGG - Intronic
1065943642 10:30587650-30587672 GCTCTGGGGCAGTCCCAGCTGGG - Intergenic
1067546287 10:47194747-47194769 GCTGTGGGGCAGACACAGCTGGG + Intergenic
1069572720 10:69504117-69504139 GCTCTGGGGCGGTCATAGCCCGG + Intronic
1070236980 10:74638736-74638758 GCTTTCTGGCAGTGTCATCCTGG + Intronic
1078386251 11:10895533-10895555 CCTCTGGGCCAGTGACATCCTGG - Intergenic
1079342976 11:19628294-19628316 GCTCTGGGGCAAGCACACCCAGG + Intronic
1079571123 11:21944559-21944581 GCTTCAGGTCAGTCAGATCCAGG + Intergenic
1084815383 11:71642809-71642831 GCTGTGGGTCAGACACACCCTGG - Intergenic
1087411160 11:97791675-97791697 GCTTTGGGGCAGTCTTATTTGGG + Intergenic
1088602529 11:111494006-111494028 GCATTGGAGCAGTCACAGCTTGG - Intronic
1089074291 11:115725778-115725800 GCTCTGGGGCAGACACAACAGGG + Intergenic
1089174556 11:116539101-116539123 GCTTTGGGTCAGACAGATCCGGG - Intergenic
1091833669 12:3568955-3568977 GGCTTGGGGCAGTGACCTCCTGG - Intronic
1092427632 12:8387240-8387262 GCTGTGGGTCAGACACACCCTGG + Intergenic
1092428898 12:8394221-8394243 GCTGTGGGTCAGACACACCCTGG + Intergenic
1099507084 12:83491683-83491705 GCTTTTGGGTAGTCACCACCAGG - Intergenic
1101843660 12:108345011-108345033 GCTTGGGGGCAGGCAGATCTGGG + Intergenic
1102236065 12:111295482-111295504 GCTTGGGGTCTGCCACATCCAGG + Intronic
1105048660 12:133028287-133028309 GCTGTGGGGCAGGCAGCTCCAGG - Intergenic
1108286998 13:48918501-48918523 GCTTTGGGAAAGTCACAGCCAGG + Intergenic
1109683427 13:65783564-65783586 GCTTTGGGGCAGGCAGCTCCAGG + Intergenic
1111360437 13:87168401-87168423 GCCTGGGGGCTGTCACAACCTGG - Intergenic
1111485583 13:88895342-88895364 GCAATGGGGAAGTCACAGCCAGG + Intergenic
1113767394 13:112889782-112889804 GCTTCAGGGCAGTCACACCTGGG + Intergenic
1115711362 14:36054619-36054641 GCTTTGAGCCACTCACATTCTGG - Intergenic
1118900476 14:69981447-69981469 GATCTGGGGCAATCCCATCCTGG + Intronic
1119998460 14:79278392-79278414 GCCTTGGGTCAGTCCCCTCCTGG + Intronic
1120023287 14:79554003-79554025 GCTTTGGGGAAGTGAAACCCAGG + Intronic
1121463720 14:94101029-94101051 TCATTGGAGCAGTCACAGCCCGG + Intronic
1121847214 14:97183446-97183468 GCTTTAGGGAAGTCAAATCCAGG + Intergenic
1123488810 15:20764049-20764071 GCTTTGGAGCTGTCACACCTGGG + Intergenic
1123545309 15:21333136-21333158 GCTTTGGAGCTGTCACACCTGGG + Intergenic
1126109488 15:45167226-45167248 GCTCTGGAGCAGACACAGCCCGG - Exonic
1129523284 15:76198995-76199017 GCTCTGTGTCAGGCACATCCCGG + Intronic
1202953655 15_KI270727v1_random:60407-60429 GCTTTGGAGCTGTCACACCTGGG + Intergenic
1133370616 16:5243138-5243160 GCTGTGGGTCAGACACACCCTGG - Intergenic
1135136977 16:19892188-19892210 GCTCTGGGGCTGGCACATCCAGG - Intergenic
1138968944 16:62121322-62121344 GTTTTGGGGTAGTCTGATCCTGG - Intergenic
1139835310 16:69833821-69833843 GCTTTGGGCAAGTCACAGGCAGG - Intronic
1139839507 16:69867278-69867300 GCTTTGGGGAAGCCACCTGCTGG - Intronic
1139958341 16:70703974-70703996 GGTGTGGTGCAGTCACCTCCAGG - Intronic
1141183055 16:81767480-81767502 GCTTAGGGACCGTCACCTCCAGG + Intronic
1145208507 17:20996916-20996938 GCACTGGGGCAGTCAGATCCAGG + Intergenic
1146944270 17:36863358-36863380 GCTCTAGGGTTGTCACATCCTGG + Intergenic
1149652432 17:58284436-58284458 GCTTTGGGGAATCCACATCTTGG - Intergenic
1150494470 17:65596773-65596795 GTTTTGGGACAGTCTCATCTTGG + Intronic
1152277548 17:79367041-79367063 GCTGTGAGGCAGTCACAACACGG - Intronic
1152298810 17:79483725-79483747 GCTATGTGCCAGGCACATCCTGG - Intronic
1160855210 19:1214239-1214261 GCCTGGTGGCAGTCACCTCCGGG - Intronic
1162016806 19:7850675-7850697 GGAGTGGGGCTGTCACATCCAGG - Intronic
1163233150 19:16017180-16017202 ACTTGGGGACAGTCACAACCAGG + Intergenic
1163698071 19:18774042-18774064 GCTGTGGGGCAGTGGCTTCCTGG + Intronic
1165453409 19:35897897-35897919 GAGTTGGGGACGTCACATCCAGG + Intronic
1168169658 19:54576921-54576943 GCTTTGGGGCAGTCACATCCAGG - Intronic
929995957 2:46826372-46826394 GCTTTGGGGGAGCCACAGCATGG - Intronic
931995567 2:67836280-67836302 GCTTTGTGGCAATCACTTCCTGG - Intergenic
933902542 2:86860411-86860433 GCTTTGGGTCACTCACTTCTTGG + Intronic
935580921 2:104755329-104755351 GCTGTGGGACAGTTGCATCCTGG - Intergenic
935778001 2:106488857-106488879 GCTTTGGGTCACTCACTTCTTGG - Intergenic
938297756 2:130189048-130189070 GGTTTGGGGCAGTCCCTTGCAGG - Intronic
939129804 2:138221512-138221534 GCCCTGAGGCAGGCACATCCAGG + Intergenic
940844508 2:158625134-158625156 GGATTGGGTCAGTCACCTCCCGG + Exonic
944658312 2:201898851-201898873 TCTCTTGGGCAGTCACATCCTGG - Intergenic
945192276 2:207201339-207201361 GCTTTGGAGCAGACAGATCTGGG - Intergenic
946079385 2:217104352-217104374 GCTTTGGGGCAGTGATGTCAAGG + Intergenic
946432912 2:219635075-219635097 GCTTTGGGGCAGTGGCTTGCTGG + Intronic
947665808 2:231904663-231904685 GTTCTGGGGCAGTCATATTCCGG + Intergenic
948793063 2:240389050-240389072 GCTTGGGGGCAGCCAGATGCTGG - Intergenic
1170959866 20:21015813-21015835 GCTGTGGGGCAATCACATGATGG + Intergenic
1172347139 20:34210445-34210467 GCTGTGGGGCAGGCAGCTCCAGG - Intronic
1173792234 20:45834981-45835003 GCAGTGGGGCAGTCAGCTCCTGG + Exonic
1175911132 20:62406085-62406107 TCTTTGGGTCTGTCACACCCTGG - Intronic
1176025019 20:62981409-62981431 CCTTTGGGGCAGTCTCAGCTGGG + Intergenic
1176215003 20:63943854-63943876 GCGTTGGGGCAATCAGAGCCAGG + Intronic
1178413639 21:32386395-32386417 GCATTGGCATAGTCACATCCTGG - Intronic
1179163550 21:38917518-38917540 GTTTGGGGCCAGTCACATACTGG - Intergenic
1180095090 21:45552696-45552718 GGTTGGGGCCAGTCTCATCCTGG + Intergenic
1181518340 22:23430891-23430913 GCTTCCTGGCAGTCACACCCTGG - Intergenic
1181864785 22:25846475-25846497 GATTTGGATCAGTCACTTCCTGG - Intronic
1182024562 22:27107896-27107918 GCTTTGGGAAAGTGACATGCTGG + Intergenic
1183026240 22:35067750-35067772 GATTTGGGGGAGTCAGAGCCAGG - Intronic
1183356194 22:37361063-37361085 GCTAAGGGACAGCCACATCCCGG + Intergenic
1183469914 22:37999677-37999699 GCTTTGGGGCAGTCAGAGCAGGG + Intronic
1183504351 22:38201043-38201065 TCTCTGAGGCAGTGACATCCGGG + Intronic
1184767242 22:46578071-46578093 GCTCTGGGGGAGTCACACTCAGG - Intronic
950149313 3:10674020-10674042 GCTTTGGGGCAGGCAGATCCAGG + Intronic
953462706 3:43094429-43094451 GCTGTGGGGCTATCACAGCCTGG + Intronic
955463856 3:59215645-59215667 CCTTTGGGACAGCAACATCCTGG - Intergenic
957072329 3:75576934-75576956 GCTGTGGGTCAGACACACCCTGG + Intergenic
959428354 3:106221018-106221040 GCTGTGAGTCTGTCACATCCTGG + Intergenic
961281740 3:125769837-125769859 GCTGTGGGTCAGACACACCCTGG - Intergenic
961872605 3:129999747-129999769 GCTGTGGGTCAGACACACCCTGG + Intergenic
962543610 3:136409360-136409382 CCTTTGAGACAGTCTCATCCAGG + Intronic
962671745 3:137714931-137714953 GCACTGGGGCAGTCCCTTCCTGG - Intergenic
965309782 3:167114880-167114902 GCTATGGGGCAGGCAGCTCCAGG + Intergenic
969738030 4:9004103-9004125 GCTGTGGGTCAGACACACCCTGG - Intergenic
969797220 4:9535650-9535672 GCTGTGGGTCAGACACACCCTGG - Intergenic
973705945 4:53580458-53580480 GCTGTCTGGCAGTCACATCAAGG - Intronic
976640840 4:87336132-87336154 TCTTTGGAGCAGTAGCATCCTGG - Intergenic
978183883 4:105835408-105835430 GCTGTGGGGCAGGCATCTCCAGG + Intronic
980740731 4:136946848-136946870 GGTGTGGGGCTGTCACTTCCAGG + Intergenic
982206019 4:152997727-152997749 GGTTTGGGGCTGTCATATTCAGG - Intergenic
985811432 5:2092080-2092102 GCTTTGGAGCAGGAACATCTAGG - Intergenic
986175474 5:5348448-5348470 GGTTTGGGGCCGACACATCTAGG + Intergenic
986721362 5:10563641-10563663 GCTGTGGGGGAGTCCCAGCCCGG - Intergenic
995321288 5:110837145-110837167 GCAGTGGCACAGTCACATCCAGG - Intergenic
996238829 5:121169694-121169716 GTTTTGGGGTAATCACATTCAGG + Intergenic
997660861 5:135588582-135588604 GCTGTAAGGCAGTCCCATCCAGG + Intergenic
1003371689 6:5533798-5533820 CTTTTGGGGCAGTCATGTCCGGG - Intronic
1005315579 6:24599819-24599841 GCTCTGGGGCAGTCACAGGAGGG - Intronic
1007842515 6:44728337-44728359 GCCTTGGGGCAGACACCTCCTGG + Intergenic
1013709524 6:112880379-112880401 GATTTGGGGCAGAAACTTCCCGG - Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1020255800 7:6502616-6502638 CCTTTGCTGCAGTCACATCCTGG + Intronic
1027217393 7:76192740-76192762 GCTTTGGGTCAGACAAATCCTGG + Intergenic
1028626726 7:92886204-92886226 GCTTTGGGGCAGACACAATAAGG + Intergenic
1030149334 7:106387118-106387140 GCTGTGGGGCAGGCAGCTCCAGG - Intergenic
1035334822 7:158121120-158121142 CCTTTGGAGCAGTCACCACCAGG - Intronic
1035766880 8:2113485-2113507 GCCTTGGTGCAGCCACACCCTGG - Intronic
1036116397 8:5964971-5964993 GCGTTGTGTCATTCACATCCTGG + Intergenic
1036243114 8:7095377-7095399 GCTGTGGGTCAGACACACCCTGG - Intergenic
1036358540 8:8061845-8061867 GCTGTGGGTCAGACACACCCTGG - Intergenic
1036891157 8:12598114-12598136 GCTGTGGGTCAGACACACCCTGG + Intergenic
1036898713 8:12656054-12656076 GCTGTGGGTCAGACACACCCTGG + Intergenic
1036899964 8:12663083-12663105 GCTGTGGGTCAGACACACCCTGG + Intergenic
1038536886 8:28359907-28359929 GGTTTGTGGCAGGCAGATCCTGG - Intronic
1039895754 8:41715367-41715389 GCTTTGGGCAAGTCACAAACAGG - Intronic
1042160530 8:65889828-65889850 GATTTGGGGCCGTAAGATCCTGG - Intergenic
1043414628 8:80034173-80034195 GCTTGGGTGCTGTCACAACCTGG - Intronic
1047467391 8:125130620-125130642 GCTTAGAGGCAGTCACTTTCTGG - Intronic
1050928448 9:11296281-11296303 GGAGTGGGGCAGTGACATCCAGG + Intergenic
1052437077 9:28443600-28443622 GCTTGGGTGCTGTCACAACCTGG + Intronic
1059770349 9:117417718-117417740 TAGTTGGGGCAGTTACATCCAGG + Intergenic
1061588618 9:131584074-131584096 GTTCTGGGGTGGTCACATCCCGG - Intronic
1062155075 9:135043381-135043403 GCTTTGGTGCACTCACACGCTGG - Intergenic
1187515038 X:19961124-19961146 GTTTTGGGGCAGACAAATGCAGG - Intronic
1190553099 X:51605337-51605359 GCTTTGAGGCAGTCAGATTTGGG - Intergenic
1190780498 X:53589950-53589972 ACTTTGTGGCTGCCACATCCTGG - Intronic
1192502769 X:71664489-71664511 GCAGTGGGGCAGCCACAGCCAGG + Intergenic
1193198628 X:78662277-78662299 CCTTGGGGGCAGTCCCATCCTGG + Intergenic
1197703230 X:129615714-129615736 GCCTTGGGGCAGCCACATGTGGG - Intergenic