ID: 1168170801

View in Genome Browser
Species Human (GRCh38)
Location 19:54587368-54587390
Sequence CTGAGGCTCCACCACGCTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 2, 1: 0, 2: 1, 3: 13, 4: 136}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168170801_1168170808 11 Left 1168170801 19:54587368-54587390 CCTTCAGCGTGGTGGAGCCTCAG 0: 2
1: 0
2: 1
3: 13
4: 136
Right 1168170808 19:54587402-54587424 ATGATCCCAGGAGGCTCTGGAGG 0: 1
1: 1
2: 1
3: 33
4: 355
1168170801_1168170807 8 Left 1168170801 19:54587368-54587390 CCTTCAGCGTGGTGGAGCCTCAG 0: 2
1: 0
2: 1
3: 13
4: 136
Right 1168170807 19:54587399-54587421 CTGATGATCCCAGGAGGCTCTGG 0: 1
1: 3
2: 2
3: 25
4: 414
1168170801_1168170811 21 Left 1168170801 19:54587368-54587390 CCTTCAGCGTGGTGGAGCCTCAG 0: 2
1: 0
2: 1
3: 13
4: 136
Right 1168170811 19:54587412-54587434 GAGGCTCTGGAGGACAATCTAGG 0: 1
1: 1
2: 0
3: 19
4: 208
1168170801_1168170806 2 Left 1168170801 19:54587368-54587390 CCTTCAGCGTGGTGGAGCCTCAG 0: 2
1: 0
2: 1
3: 13
4: 136
Right 1168170806 19:54587393-54587415 ACAGATCTGATGATCCCAGGAGG 0: 2
1: 2
2: 1
3: 16
4: 146
1168170801_1168170805 -1 Left 1168170801 19:54587368-54587390 CCTTCAGCGTGGTGGAGCCTCAG 0: 2
1: 0
2: 1
3: 13
4: 136
Right 1168170805 19:54587390-54587412 GGGACAGATCTGATGATCCCAGG 0: 1
1: 1
2: 3
3: 14
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168170801 Original CRISPR CTGAGGCTCCACCACGCTGA AGG (reversed) Exonic