ID: 1168177384

View in Genome Browser
Species Human (GRCh38)
Location 19:54635038-54635060
Sequence AGCTGTGTGTGCAGGGCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 699
Summary {0: 2, 1: 0, 2: 9, 3: 80, 4: 608}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168177376_1168177384 -8 Left 1168177376 19:54635023-54635045 CCTTCCTTACCTTCGAGCTGTGT 0: 2
1: 0
2: 0
3: 12
4: 154
Right 1168177384 19:54635038-54635060 AGCTGTGTGTGCAGGGCAGGGGG 0: 2
1: 0
2: 9
3: 80
4: 608

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168177384 Original CRISPR AGCTGTGTGTGCAGGGCAGG GGG Intronic
900078119 1:834374-834396 AGCTGGGTGTGGAGATCAGGGGG + Intergenic
900101964 1:965842-965864 AGCTGTGCGTCCAGGGAGGGTGG + Intergenic
900146670 1:1161672-1161694 AGGTGTCTGTGTGGGGCAGGTGG - Intergenic
900312507 1:2040972-2040994 AGCTGGGTGTGGAGGGAAAGGGG - Intergenic
900331431 1:2136604-2136626 GGCTGTGTGCTTAGGGCAGGTGG + Intronic
900345806 1:2209783-2209805 GGGGGTGTGAGCAGGGCAGGAGG - Intronic
900461219 1:2802842-2802864 GTCTGAGGGTGCAGGGCAGGGGG + Intergenic
900512058 1:3065475-3065497 GGCCGTGTGTGCAGGACAGGAGG - Intergenic
900518389 1:3094117-3094139 ACCTGAGTGTGCAGGGCAAGAGG + Intronic
900545839 1:3228762-3228784 AGCTGGGTGGACAGTGCAGGTGG - Intronic
900760404 1:4466719-4466741 CACTGTGTCTGCAGGGCAGTAGG - Intergenic
901143638 1:7051433-7051455 AGCTGCGTGGGGTGGGCAGGTGG + Intronic
901292047 1:8131629-8131651 AGCAGTGTGGGCCGGGCAGGTGG - Intergenic
901319305 1:8330000-8330022 AGGTGGCTGTGCAGGACAGGAGG + Intronic
901393637 1:8964577-8964599 AGATGTGTGTGCTGAGCAGGAGG - Intronic
901425168 1:9178049-9178071 GGCTGGGTGTCCAGGGCAGGGGG + Intergenic
902117095 1:14130238-14130260 AAATGTGTGGGGAGGGCAGGTGG + Intergenic
902232391 1:15036286-15036308 AGCTGGGCGGGCAGGGCAGAGGG - Intronic
902232429 1:15036389-15036411 AGCTGGGTGGTCAGGGCAGGGGG - Intronic
902288971 1:15424497-15424519 ACCTGAGAGTGCAGGGCAGAGGG + Intronic
902289911 1:15429069-15429091 AGGGATGTGTGGAGGGCAGGCGG - Exonic
902403577 1:16171436-16171458 AGGTGTGTGTGCATGGTGGGTGG + Intergenic
902619747 1:17644008-17644030 AGCTTTGTGAGCAGAGCAGGTGG - Intronic
903391959 1:22971009-22971031 AGCTCTGTGTTCATGCCAGGAGG - Intergenic
903554844 1:24186114-24186136 ACCTGTGTGTGGAGGGAGGGTGG - Intronic
903680720 1:25094978-25095000 GTCTGTGTGTTGAGGGCAGGTGG - Intergenic
903791498 1:25896313-25896335 AGCTGTGAGAGCAGGGAAGAGGG + Intronic
903995756 1:27304635-27304657 AGTGGTGTGTGAGGGGCAGGGGG + Intronic
904326359 1:29729124-29729146 TGCCGTGTGTGGTGGGCAGGAGG - Intergenic
904605801 1:31696942-31696964 AGGTGGGTGGGCAGGACAGGTGG - Exonic
904611630 1:31729008-31729030 ACCTGTGTTTGCAGGACAAGTGG - Intronic
904775381 1:32902794-32902816 CGCTGTGTGTGTTGGGCAGTTGG + Intergenic
905218886 1:36430380-36430402 AGCTATGTAGGCAAGGCAGGAGG + Intronic
905231479 1:36517186-36517208 TGCTGTGGGTGCAGGGGACGGGG + Intergenic
905548369 1:38817666-38817688 ATCTGTGTGGGCAGAGGAGGTGG - Intergenic
905789631 1:40783393-40783415 ACTTGTGTGTGCAGGGTGGGTGG - Intergenic
906103029 1:43275204-43275226 ATGTGTGTGTGCATGGCAGGGGG - Intergenic
906608906 1:47188975-47188997 TGCTGTATGTGCATGGGAGGAGG - Intronic
906726664 1:48049175-48049197 AGCTGTCTGAGGAGGGCAGGAGG + Intergenic
907046530 1:51303256-51303278 AGCTGTGTGGGCAGTGCTGCCGG + Intronic
907438131 1:54462490-54462512 AGCTGGGGGGGCAGGGGAGGGGG - Intergenic
907479929 1:54738452-54738474 AGCTCTGTGCTCAGGGCAGAAGG - Intronic
907500359 1:54875246-54875268 AGCTGTGGGTACAGGGTTGGGGG + Intronic
907827976 1:58037188-58037210 ATCTGTGTGTGCAGGCAAAGGGG - Intronic
908394606 1:63713961-63713983 ATCTGTGTGTTCAGGGCACATGG - Intergenic
910510555 1:87999389-87999411 AGCTGTGTGTTCAAAGAAGGAGG + Intergenic
910771226 1:90834700-90834722 AGCCGTGTGTGCAGGAGAGAGGG - Intergenic
911045918 1:93628263-93628285 ACCTGTGAGAGCAGGGGAGGTGG - Intronic
911528885 1:99019939-99019961 AGATGTGTTTGCAAGGCAAGTGG + Intergenic
912945312 1:114079609-114079631 ACCTGGATGTGCAGGGCAGCGGG + Intergenic
913247771 1:116885370-116885392 GGCGGTTTGTGCAGGGCAGTTGG - Intergenic
913968653 1:143397250-143397272 AGCAGTGTCTGGACGGCAGGTGG - Intergenic
913997084 1:143660543-143660565 GGCTGTGTGTGCAGGCCAAATGG - Intergenic
914063032 1:144222849-144222871 AGCAGTGTCTGGACGGCAGGTGG - Intergenic
914116118 1:144743505-144743527 AGCAGTGTCTGGACGGCAGGTGG + Intergenic
914300934 1:146376679-146376701 AGCTGTGTGTGAGGGCTAGGAGG + Intergenic
914302269 1:146387319-146387341 AGCTGTGTGTGAGGGCTAGGAGG + Intergenic
914505169 1:148282244-148282266 GGCTGTGTGTGCAGGCCAAATGG + Intergenic
914507396 1:148301904-148301926 GGCTGTGTGTGCAGGCCAAATGG - Intergenic
914912469 1:151798992-151799014 AGTTGTGTGTGCATGGTGGGTGG + Intergenic
915017309 1:152746023-152746045 AGGAGTGTGTGGGGGGCAGGAGG - Intronic
915635772 1:157185524-157185546 TGCTGTGTGTGGTGAGCAGGTGG - Intergenic
917836076 1:178942558-178942580 AGCTGTGTGACCTGGGCAGCAGG - Intergenic
917864315 1:179178743-179178765 AGCTGAGTGTGGTGGGCTGGGGG + Intronic
918931790 1:190864250-190864272 AGCTGCATGTTCTGGGCAGGCGG + Intergenic
920766936 1:208842427-208842449 ATACGTGTGTGCAGGGGAGGTGG - Intergenic
922383907 1:225061512-225061534 AGCAGTGGGTGCAGGACAGTGGG - Intronic
922884926 1:229012161-229012183 ATCTGGGTGTCCAAGGCAGGGGG - Intergenic
923048787 1:230375444-230375466 AGATGAGAGTGCAGTGCAGGAGG - Intronic
923155892 1:231279103-231279125 AGCTGTGAGTCCAGGGCAATTGG + Intergenic
923331331 1:232927602-232927624 ACCTGAGTGAGCAGAGCAGGAGG + Intergenic
1062904494 10:1170685-1170707 AGCTCTGTGTGGAGGGGAGAGGG - Intergenic
1063884047 10:10559983-10560005 AGCTGACTGTGCAGGGCTTGAGG + Intergenic
1064000833 10:11662611-11662633 AGCTGTGTGTTGGGGGCAGGAGG - Intergenic
1064598665 10:16971771-16971793 AGTTGTGTGAAGAGGGCAGGTGG - Intronic
1066312350 10:34210233-34210255 ATGTGTGTGTGTAGTGCAGGTGG + Intronic
1067435167 10:46272061-46272083 AGGTCTGGGTGCAGGGCTGGGGG - Intergenic
1068290996 10:55001365-55001387 AAGTGTGTGTGTAGAGCAGGGGG - Intronic
1069872103 10:71539402-71539424 AGCTTAGTGTGCAGGGCCAGGGG + Intronic
1070506824 10:77120738-77120760 AGCTGTGCATGCAGGGAAGTAGG - Intronic
1070664447 10:78333302-78333324 AGCTGTGTGTGGAGCCCATGAGG + Intergenic
1070975987 10:80606021-80606043 AGCTGTGCATACAGGGCAGCAGG + Intronic
1071457433 10:85861690-85861712 AGCGAGGTGTGCAGGGGAGGTGG + Intronic
1072807579 10:98434197-98434219 AGCTGTGTGGGCAGGTCATATGG - Intronic
1073511819 10:104047178-104047200 AGCTGTGTGGTCAAGGCGGGTGG - Intronic
1074115610 10:110455652-110455674 AAGTGTGTGTGCAGGTCTGGAGG + Intergenic
1075401508 10:122164223-122164245 AGCAGTGGGTGCATGGCTGGGGG + Intronic
1075941508 10:126394267-126394289 TGCCGTGTCTTCAGGGCAGGAGG + Intergenic
1076066262 10:127450586-127450608 AGGTGTGTGTGATGGGCATGAGG + Intronic
1076364649 10:129914199-129914221 GGATGTGGGTGCAGGGCTGGAGG - Intronic
1076754968 10:132564672-132564694 GGCAGTGAGTGCAGGGCAGACGG + Intronic
1076855087 10:133111876-133111898 AGGTGTCTGTGGTGGGCAGGTGG - Intronic
1076855122 10:133112002-133112024 AGGTGTCTGTGGTGGGCAGGTGG - Intronic
1076907938 10:133372762-133372784 GGCTGTGGGTGCGGGTCAGGTGG + Intronic
1077302657 11:1854411-1854433 AGCTTTGTGTGAAGGCCGGGAGG - Intronic
1077542515 11:3153985-3154007 TGCTGTGTGTGCGGGGCTGACGG - Intronic
1077616365 11:3677033-3677055 AGCTGTGTGCAGGGGGCAGGAGG + Intronic
1078333377 11:10444384-10444406 ATGTGTGTGTGGTGGGCAGGTGG + Intronic
1078545508 11:12244174-12244196 AGATGTTTGTGCAGGTCAAGTGG - Intronic
1079928570 11:26527903-26527925 AGCTGTGAAAGCAGGGCATGGGG - Intronic
1080136237 11:28857845-28857867 AGCATTATGTGCAGGGCAGCAGG + Intergenic
1080402140 11:31946221-31946243 AGCTCTCTGTGGAGGGTAGGGGG - Intronic
1081261083 11:40961866-40961888 TGCTGTGTGTTTAGGGTAGGGGG + Intronic
1081607303 11:44535453-44535475 AGAAGTCTGGGCAGGGCAGGAGG + Intergenic
1081965224 11:47165212-47165234 AGCTGTGGGGGCAGGACAGAAGG + Exonic
1081991782 11:47341970-47341992 CGGTGAGTGTGCAGGGCAGGTGG - Exonic
1082716973 11:56625898-56625920 AGCTCTGTGTACAATGCAGGAGG - Intergenic
1083078490 11:60066570-60066592 AGCTGTGGGTGCCAGCCAGGAGG - Intronic
1083151176 11:60792779-60792801 AGCCATGTGTGCAGGGGAGAGGG - Intronic
1083305909 11:61761911-61761933 AGCTGTGGGTGGTGGGCGGGTGG + Intronic
1083327561 11:61880583-61880605 AGCAGTGGGTGAAGGGTAGGTGG + Intronic
1083582268 11:63832592-63832614 AGCTGTGTGTGGGGTGGAGGTGG - Intergenic
1083653720 11:64219273-64219295 AGCTGTATGAGCAGGCCCGGTGG + Exonic
1083757615 11:64800170-64800192 AGCTGTGTGAGGAGGGCCCGAGG + Exonic
1084041589 11:66545998-66546020 AGCTGGGTGTCCAGGCCATGGGG - Exonic
1084177229 11:67429206-67429228 TGCTGCGTGTGCTGGGCAAGGGG + Exonic
1084455528 11:69266061-69266083 AGCTGTGTGGGCAGGACCTGAGG - Intergenic
1084506029 11:69568882-69568904 ACCTGTGTGTGCACTGCATGTGG + Intergenic
1084548428 11:69826051-69826073 AGGTGACTGTGCAGTGCAGGAGG - Intergenic
1084577793 11:70001169-70001191 AGCTGTATGTGAGGAGCAGGTGG - Intergenic
1084696123 11:70756532-70756554 AGCTGTGTGGGCAGGGGCTGTGG + Intronic
1085404723 11:76255003-76255025 AGGTGTGTGTGCAGGGGTGGGGG + Intergenic
1085465814 11:76722521-76722543 AGGTGTGTATGCAGGGCACAGGG - Intergenic
1085507873 11:77070365-77070387 GGCTGGCTGGGCAGGGCAGGTGG - Intronic
1086436998 11:86791361-86791383 ATCTGTGTGCGGAGGGCAGAAGG + Intronic
1086468949 11:87086307-87086329 AGGCCTGGGTGCAGGGCAGGGGG - Intronic
1088018745 11:105092816-105092838 ATGTGTCTCTGCAGGGCAGGAGG + Intronic
1088572847 11:111240515-111240537 AGCTGAGTGAGCTGGGCTGGTGG - Intergenic
1088711858 11:112515812-112515834 AGATCTGTGGGCAGGGGAGGGGG - Intergenic
1089153941 11:116386152-116386174 ACCTGTGGGTGCAGGGAAGCCGG + Intergenic
1089164239 11:116462390-116462412 AGATGTGTGTGCAGGGATGCAGG - Intergenic
1089264245 11:117246927-117246949 AGCTTTGTGAGAAGGGCAGAAGG + Exonic
1089401802 11:118168662-118168684 AGTTGAAGGTGCAGGGCAGGCGG + Exonic
1089597415 11:119589679-119589701 ACCTGTATGTGCAGGGGTGGGGG - Intergenic
1090042132 11:123300477-123300499 ACCTGTATGTGCAGGGCATTGGG - Intergenic
1090645679 11:128765033-128765055 AGGTGTGTGCACAGGGCCGGGGG + Intronic
1090977749 11:131691172-131691194 GGCTGTGGGTGCAGGGCCGGGGG - Intronic
1091168972 11:133503921-133503943 AGAAGTGTGGGCAGGGAAGGCGG + Intronic
1091400296 12:177136-177158 AGCTGTGTGAGCAGGGGACGGGG - Exonic
1091400306 12:177186-177208 AGCTGTGTGAGCAGGGGACGGGG - Exonic
1091400315 12:177236-177258 AGCTGTGTGAGCAGGGGACGGGG - Exonic
1091400325 12:177286-177308 AGCTGTGTGAGCAGGGGACGGGG - Exonic
1091412632 12:254140-254162 AGCTGAGGGTGGAGGGCTGGAGG + Intronic
1091449458 12:563320-563342 AGGGGTGTGGGCAGGGCAGGAGG - Exonic
1091609721 12:1995638-1995660 GTCTGTGTATGCTGGGCAGGAGG - Intronic
1092147405 12:6224095-6224117 GGCTGGGAGTGCAGGGCTGGTGG + Intronic
1096627921 12:52906588-52906610 TGCTGTGGGTGGAAGGCAGGAGG + Intronic
1096680933 12:53254904-53254926 AGCTGTGTGGGAAGGGCCTGAGG + Intergenic
1096801867 12:54115718-54115740 GGCTGTGTCTGAAGGGCAGCAGG + Intergenic
1096817479 12:54210646-54210668 AGCTCTGGGGGCAGGGCAGGGGG - Intergenic
1096952040 12:55483851-55483873 ACCTGTGTGTGTGTGGCAGGGGG - Intergenic
1097134283 12:56838662-56838684 AGCTGTTTGAGCATGCCAGGGGG + Intergenic
1097837215 12:64285095-64285117 AGCTGAGTGTGGAGCTCAGGAGG + Intronic
1097844316 12:64351324-64351346 AAATGTGTCTGCAGGGGAGGGGG - Intronic
1099919816 12:88943527-88943549 AGGTGTGTGCACAGGGCACGGGG - Intergenic
1101574752 12:105987163-105987185 AGCTCTGTGGGCTGGCCAGGTGG + Intergenic
1101845496 12:108360059-108360081 AGCTGTGTGAGCAGGCAGGGTGG + Intergenic
1102797349 12:115700344-115700366 ATCTGTGTGGGAAGGGCAGAAGG - Intergenic
1103002574 12:117396446-117396468 AACAGTGTGTGCAAGGCATGGGG + Intronic
1103491963 12:121328380-121328402 GGCTGTGTTTCCAGTGCAGGAGG + Exonic
1103724488 12:122990972-122990994 AGGGGTGTGTGTGGGGCAGGAGG - Intronic
1104067356 12:125316867-125316889 AGGTTTGGGAGCAGGGCAGGAGG + Intronic
1104298035 12:127536388-127536410 ACCTGAGGGTGGAGGGCAGGAGG + Intergenic
1104464702 12:128980740-128980762 AGCTTTGTGTGGAAGGCAGACGG + Intronic
1104655160 12:130568925-130568947 GGCTGTGTGAGGAGGGCACGTGG - Intronic
1104969814 12:132526192-132526214 GCCTGTGGGTGGAGGGCAGGCGG + Intronic
1105309085 13:19190271-19190293 GGCTGGGTGTGCAGGGATGGAGG + Intergenic
1105503679 13:20992376-20992398 GGCTGTGGGTGCAGAGCTGGAGG + Intronic
1105528520 13:21197877-21197899 GGCTGGGTGTGCAGGGATGGAGG - Intergenic
1106250374 13:27978024-27978046 AGCTGTGCGTCCTGGGCGGGAGG - Exonic
1106447449 13:29849734-29849756 AGCTGTGTGGCCGGAGCAGGAGG + Exonic
1107172990 13:37365376-37365398 GTGTGTGTGGGCAGGGCAGGGGG + Intergenic
1109006593 13:56885455-56885477 AGCTGTGTGTTCAGTCAAGGAGG - Intergenic
1109696793 13:65971686-65971708 AGGTGTGTGTACAAGGGAGGAGG + Intergenic
1110334630 13:74313248-74313270 ACCTGAGTGTGGAGGGTAGGAGG - Intergenic
1110569804 13:76991674-76991696 AGCTGAGGGTGCAGGGCTGGGGG - Exonic
1110763247 13:79253429-79253451 AGCTGTGTGTGGAGGAAAGAAGG - Intergenic
1112102166 13:96200965-96200987 GGCTGTGAGTTCATGGCAGGTGG + Intronic
1112516602 13:100058671-100058693 AGGTGAGTCTGCAGGGCGGGTGG + Intergenic
1112622510 13:101066555-101066577 ATCTCGGTGTGCAGGGCAGTGGG + Intronic
1113104153 13:106755048-106755070 AGCTGTGTTTGAGGGGCAGTTGG + Intergenic
1113444354 13:110354205-110354227 AGTTGTCTGGGAAGGGCAGGCGG - Intronic
1113531937 13:111033502-111033524 CAGTGTGTGTACAGGGCAGGGGG + Intergenic
1113627281 13:111856588-111856610 AGCTGTGGCTGCAGGAAAGGTGG + Intergenic
1113781165 13:112978363-112978385 AGGTGGGTGTGGAAGGCAGGAGG + Intronic
1113786895 13:113006749-113006771 TGCTGAGTGGGCAGGGCTGGTGG - Intronic
1113882678 13:113636431-113636453 AGCTGTGTGTGGCGGTCAGCGGG + Intronic
1113956533 13:114102489-114102511 AGCTGCGTGGGACGGGCAGGAGG + Intronic
1114494503 14:23123347-23123369 AGGTGTGTGTGCTGGGAAAGAGG + Intergenic
1114534925 14:23416843-23416865 GTGTGTGTGTGCAGGGCACGGGG - Intronic
1114807817 14:25857850-25857872 GGCTGTGGGTGCAGGACAGTGGG - Intergenic
1115748447 14:36462432-36462454 AGAGGTGTGTGCACGCCAGGAGG + Intergenic
1115960047 14:38825740-38825762 AATTGTGTGTGGAGGGCTGGGGG - Intergenic
1117017881 14:51536938-51536960 GACTGTGTGTGGGGGGCAGGGGG - Intronic
1117715341 14:58574451-58574473 AGCAGTTTTTGCAGGGCAGAAGG - Intergenic
1118162196 14:63301781-63301803 AGGTGTGTGTTCAGGAGAGGAGG - Intergenic
1118466082 14:66032459-66032481 AGCAGTGGGTGCAGGACAGTGGG - Intergenic
1118672173 14:68140700-68140722 AACTCTGTGAGCATGGCAGGGGG - Intronic
1119185422 14:72638253-72638275 AACAGTGTGTGAAGGTCAGGCGG + Intronic
1119740006 14:77008103-77008125 AGGTGTGGGTGAAGGGCAGCAGG + Intergenic
1119904201 14:78286563-78286585 AGCTGAGAGTCCAGGGCAGTGGG + Intronic
1121235471 14:92388700-92388722 ATCTGTTTGTTCAGGGCAGGTGG + Intronic
1121628937 14:95408713-95408735 AGCTGTGTGTGCATGTGAAGGGG - Intronic
1122117212 14:99533786-99533808 ACAGGTGGGTGCAGGGCAGGTGG + Intronic
1122203265 14:100135521-100135543 AGGTGTGTGTGCTGCACAGGGGG + Intronic
1122308039 14:100777699-100777721 CCCTGTGTGGGCAGGGCATGGGG + Intergenic
1122356285 14:101124806-101124828 GTCTGTGTGTGCTGGGAAGGGGG - Intergenic
1122394532 14:101414093-101414115 AGCTGTTTTTTCAGGGGAGGAGG + Intergenic
1122691607 14:103534389-103534411 AGCTGGGACTGCAGGGCAGAGGG - Intronic
1122728549 14:103777585-103777607 AGCAGCATGTGAAGGGCAGGTGG + Intronic
1122853460 14:104548737-104548759 AGGGGTGGGGGCAGGGCAGGGGG - Intronic
1122921159 14:104880840-104880862 AGATGTGTGTACAGGGGTGGGGG - Intronic
1122921171 14:104880887-104880909 AGCTGTGTGTGTGGGGTAAGAGG - Intronic
1122946487 14:105012929-105012951 ATGTGTGTGTCCGGGGCAGGGGG + Intronic
1122977454 14:105176751-105176773 AGCTGTGTATGCGGGTGAGGTGG - Exonic
1123010411 14:105346981-105347003 AGCTGTGTGGGCAGAGGTGGGGG - Intronic
1123036318 14:105473386-105473408 GGGTGTGTGTGCAAGGGAGGAGG + Exonic
1123675476 15:22706975-22706997 AGCTGTGTGTGTATGGGAGTAGG + Intergenic
1124170495 15:27368294-27368316 AGGTGTGTGGGCAAAGCAGGTGG + Intronic
1124218858 15:27832240-27832262 GCCAGTGTGTGCAGGGCAGGTGG - Intronic
1124327469 15:28779921-28779943 AGCTGTGTGTGTAAGGGAGTAGG + Intergenic
1124530434 15:30500750-30500772 ATTTGTGTCTGGAGGGCAGGGGG - Intergenic
1124768225 15:32506938-32506960 ATTTGTGTCTGGAGGGCAGGGGG + Intergenic
1124769178 15:32515765-32515787 AGCTGTGTGTGTATGGGAGTAGG - Intergenic
1125102494 15:35930665-35930687 AACTGTGTCTCCAGAGCAGGCGG - Intergenic
1126670402 15:51110695-51110717 CACTGCTTGTGCAGGGCAGGTGG - Intergenic
1127344102 15:58077345-58077367 AGCTCTCTGTGCAGGCCAGCAGG + Intronic
1127757927 15:62111338-62111360 ACCTGTGGGAGCAGAGCAGGTGG + Intergenic
1128605154 15:69031513-69031535 TGCAGTGTGTGCACGGCAGGGGG + Exonic
1128979649 15:72176747-72176769 AGCTGAGTGAGAAGTGCAGGTGG - Intronic
1129035558 15:72646573-72646595 AGATGTTAGTGCTGGGCAGGGGG - Intergenic
1129214326 15:74090643-74090665 AGATGTTAGTGCTGGGCAGGGGG + Intergenic
1129399681 15:75274724-75274746 AGATGTTAGTGCTGGGCAGGGGG - Intronic
1129473225 15:75766587-75766609 AGATGTTAGTGCTGGGCAGGGGG + Intergenic
1130092859 15:80835691-80835713 ACCTGTGTGTCCAGGGTTGGTGG + Intronic
1130395403 15:83496801-83496823 AGCTGTGATTCCAGGTCAGGAGG + Intronic
1131055478 15:89372052-89372074 AGATGGGTGTGAAGGGAAGGTGG + Intergenic
1131087479 15:89589026-89589048 AGCAGTGTGTTCAGGGCAGGAGG + Intronic
1131510165 15:93045298-93045320 GGCTGTGGGTGCAGGGCTGGCGG + Exonic
1131614675 15:94003955-94003977 AGCATTGTGTGAAGGGGAGGGGG - Intergenic
1132310566 15:100854468-100854490 GGCTGTGTGTGCAGGAGAGCAGG + Intergenic
1132518002 16:374786-374808 AGCTGTGTCTGCGGAGCAGGAGG + Exonic
1132539139 16:500131-500153 AGCTGTGTGTGCAGAGACCGGGG + Intronic
1132557349 16:578502-578524 ATCAGTGAGTGCAGGGCAGGCGG + Exonic
1132577762 16:671817-671839 TGATGTGTGTGCCGGGGAGGGGG - Intronic
1132659279 16:1054317-1054339 AGGAGGGTGTGCAGGCCAGGAGG - Intergenic
1132659284 16:1054334-1054356 AGGAGGGTGTGCAGGCCAGGAGG - Intergenic
1132659289 16:1054351-1054373 AGGAGGGTGTGCAGGCCAGGAGG - Intergenic
1132775547 16:1591757-1591779 TGAGGTGTGAGCAGGGCAGGGGG - Intronic
1133033590 16:3022884-3022906 AGCTGGGGTTGCAGGGTAGGGGG + Exonic
1134017798 16:10901553-10901575 AGCCAGGTGTGCAGGGCAGGTGG + Exonic
1134059013 16:11187908-11187930 AGCTGGGAGAGAAGGGCAGGAGG + Intergenic
1134215060 16:12310965-12310987 AGCTGTGGGAGAAGGGAAGGAGG + Intronic
1134225455 16:12386425-12386447 AGCTCTGTGAGCAGGGCAAGTGG - Intronic
1134633864 16:15777571-15777593 AGAGGTGTGTGCAGGGCTGCAGG + Intronic
1135109713 16:19681236-19681258 AGCAGCATATGCAGGGCAGGAGG + Intronic
1135424323 16:22324789-22324811 ATCTGGGTGTGAAGGGCAGGTGG + Intronic
1136286679 16:29248291-29248313 GGCTCCCTGTGCAGGGCAGGTGG - Intergenic
1137033189 16:35543959-35543981 AACAGTGTGGACAGGGCAGGAGG - Intergenic
1137410021 16:48220484-48220506 AGCTGTGGGTCAAGTGCAGGAGG + Intronic
1138283310 16:55788964-55788986 AGCCGAGGGTGCAGTGCAGGAGG + Intergenic
1138285691 16:55808023-55808045 AGCCGAGGGTGCAGTGCAGGAGG - Intronic
1139751030 16:69108911-69108933 AGGAGTGGGTGCAGGGTAGGGGG + Intronic
1139948563 16:70658111-70658133 AGCTGGCTGGGCAGGGCAGCAGG - Intronic
1139958370 16:70704124-70704146 GGCTGTGTGTGGATGCCAGGTGG - Intronic
1140112585 16:72016537-72016559 AGCTCTGTATGAAGGCCAGGGGG + Intronic
1140475266 16:75236785-75236807 ACCAGTGTCTGCAGGGCTGGGGG - Intronic
1140736032 16:77898602-77898624 GGCTGTGTGTGCAGGGCTTAAGG + Intronic
1140907890 16:79425445-79425467 AACTCAGTGTTCAGGGCAGGAGG + Intergenic
1141398716 16:83727726-83727748 GCCTGTGTGTTCAGGACAGGAGG + Intronic
1141624145 16:85252640-85252662 AGCTGTGGCTTCAGGGGAGGAGG + Intergenic
1141733353 16:85836681-85836703 AGCAGTGAGGGCAGGGCAGCTGG - Intergenic
1141737540 16:85863639-85863661 ATCTGTGTTTGCAGGGCACTGGG - Intergenic
1141853024 16:86660451-86660473 AGCTGAGTCTGCAGGGCAGGTGG - Intergenic
1142171188 16:88623696-88623718 TCATGTGTGTGCAGGACAGGAGG - Intronic
1143439426 17:6957572-6957594 ACCTGTGTGTGTGGGGTAGGAGG - Intronic
1143476395 17:7205881-7205903 AGGTGGGTGTGCTGGGAAGGAGG - Intronic
1143519182 17:7435999-7436021 AGCTGGGTGTGCAGGAGAGCTGG + Exonic
1143645783 17:8229162-8229184 AGCTGTCTGCGTAGGGCAAGTGG + Exonic
1143761027 17:9104515-9104537 AGCTGTGAGGGCAGAGCAGAGGG + Intronic
1143871292 17:9958930-9958952 AGCCGTTTTTTCAGGGCAGGAGG - Intronic
1144795904 17:17891162-17891184 AGCAGTGTGTGCTGGCCATGGGG - Intronic
1145052153 17:19671029-19671051 AGCAGTGTGAGCTGGGCAGAGGG - Intronic
1145103029 17:20092590-20092612 AAATGTGTGTTCAGGGCAGGAGG - Intronic
1145272002 17:21409791-21409813 ATCACTGTGTGCAGGGCATGGGG - Intronic
1145282261 17:21476778-21476800 AGCAGCTTGGGCAGGGCAGGAGG + Intergenic
1145310208 17:21697254-21697276 ATCACTGTGTGCAGGGCATGGGG - Intronic
1145391717 17:22460482-22460504 ACCTGTGTGTCCTGAGCAGGGGG + Intergenic
1145395175 17:22488823-22488845 AGCAGCTTGGGCAGGGCAGGAGG - Intergenic
1145761759 17:27429527-27429549 AGCTGCCTGGGCATGGCAGGTGG - Intergenic
1146063076 17:29617198-29617220 AGCTATGTGCGCAGGGGAGGAGG - Intronic
1146252464 17:31360613-31360635 AGCTGGCTCTGCAGTGCAGGAGG - Exonic
1146273568 17:31500029-31500051 GGCTCTGTTTGCAGGGCAGAGGG + Intronic
1146521243 17:33527170-33527192 AGATGTGTGTGCCAGGGAGGAGG + Intronic
1146674346 17:34762971-34762993 AGCTGTGGGGGCAGTGAAGGTGG - Intergenic
1147166087 17:38594149-38594171 TGCTGTTTGTGCAGGGAAGCGGG + Intronic
1147425095 17:40342473-40342495 AGTTGTGTGTGCTGGGAGGGGGG - Intronic
1147537074 17:41328044-41328066 AGCTGTATGGGCATGGGAGGTGG - Intergenic
1148865347 17:50625507-50625529 ACCTATGTGTGGAGGGCAGCAGG + Intronic
1149387899 17:56159941-56159963 AGGGGTGGGGGCAGGGCAGGAGG + Intronic
1151139961 17:71981974-71981996 ACATGTGTGTGGAGGGTAGGTGG - Intergenic
1151361672 17:73592924-73592946 TGCTGTGTTTGCAGCGCATGGGG + Intronic
1151434781 17:74088330-74088352 TGATGTGTGTGCAGGGGATGGGG - Intergenic
1151508912 17:74546447-74546469 CGCTGTGTGTGTAGGTCTGGGGG - Intergenic
1151644493 17:75420776-75420798 GGATGTGTGTGCAAGGCAGCAGG + Intergenic
1151804173 17:76395530-76395552 AGCCGTGTGTCCAGGCCAGATGG - Intronic
1151815105 17:76467931-76467953 AGCTGGATGTGTGGGGCAGGGGG + Intronic
1152684501 17:81687422-81687444 CACTGGGTGGGCAGGGCAGGTGG + Intronic
1152702894 17:81828271-81828293 GGCTATGTGTGCAGGGTCGGGGG - Intronic
1152732482 17:81979133-81979155 TGCTGAGTGTGCAGGGCTGGCGG - Intronic
1153522217 18:5963918-5963940 TTCTGTGGGTGCAGGGCAAGTGG - Intronic
1153713380 18:7821777-7821799 TGATTTGTGGGCAGGGCAGGTGG + Intronic
1153919782 18:9778265-9778287 AGCCGTGTGTGCATGGAGGGAGG + Intronic
1154132326 18:11748004-11748026 AGCAGTGGGAGCAGGGCTGGTGG - Intronic
1154163097 18:11994527-11994549 AGCTGTGTGTGTGGAGGAGGCGG - Intronic
1154189885 18:12221179-12221201 AGGGGTGTGTGGGGGGCAGGAGG + Intergenic
1154311028 18:13266289-13266311 AGCTGTGAATGCAGGGCTGGAGG - Intronic
1155157242 18:23167993-23168015 AGCTGTGTGGGCAGGACTGGTGG + Intronic
1155166643 18:23237422-23237444 AGTGGTGTTTGCAGGCCAGGTGG - Intronic
1156449403 18:37258581-37258603 AGGTGAGTGGGGAGGGCAGGAGG + Intronic
1157518832 18:48330785-48330807 GGCTGTGAGGGCTGGGCAGGGGG + Intronic
1157546422 18:48549824-48549846 AGCTGTGTTTGCAAGGAAGTGGG + Intronic
1157581987 18:48779002-48779024 AGCTGTGTGGCCTGGGCAAGTGG + Intronic
1159794377 18:72823591-72823613 GGAGGTGTGGGCAGGGCAGGTGG + Intronic
1160025878 18:75215800-75215822 ACCTGTGTGTGCAGGGTGGTAGG - Intronic
1160035361 18:75296712-75296734 ACCTGTGTGTGCAGAGCAGGGGG + Intergenic
1160632226 18:80254582-80254604 TCATGTGAGTGCAGGGCAGGGGG + Intergenic
1160731106 19:642205-642227 AGCTGTGAGGGCCGGGCTGGGGG + Intronic
1160731120 19:642247-642269 AGCTGTGAGGGCCGGGCTGGGGG + Intronic
1160731134 19:642289-642311 AGCTGTGAGGGCCGGGCTGGGGG + Intronic
1160731148 19:642331-642353 AGCTGTGAGGGCCGGGCTGGGGG + Intronic
1160731162 19:642373-642395 AGCTGTGAGGGCCGGGCTGGGGG + Intronic
1160731178 19:642413-642435 AGCTGTGAGGGCCGGGCTGGGGG + Intronic
1160731192 19:642453-642475 AGCTGTGAGGGCCGGGCTGGGGG + Intronic
1160731206 19:642495-642517 AGCTGTGAGGGCCGGGCTGGGGG + Intronic
1160731220 19:642537-642559 AGCTGTGAGGGCCGGGCTGGGGG + Intronic
1160731236 19:642577-642599 AGCTGTGAGGGCCGGGCTGGGGG + Intronic
1160731265 19:642657-642679 AGCTGTGAGGGCCGGGCTGGGGG + Intronic
1161107873 19:2453555-2453577 AGCCGTGTCTGCAGGGCATGTGG - Intronic
1161267447 19:3370885-3370907 CGCTGTGTGCTCAGGGCAGATGG - Intronic
1162382591 19:10340268-10340290 AGCTCTTTGTGCAGGGGATGGGG - Intergenic
1163078167 19:14915107-14915129 AGAAGTGTGTGCAAGGCAGAAGG - Intergenic
1163289368 19:16369452-16369474 AGGTGTGTGAGGTGGGCAGGGGG + Intronic
1163822939 19:19506479-19506501 ACAGGTGTGTGCAGGTCAGGAGG + Exonic
1164670443 19:30069286-30069308 GGCTGGGTGGGCAGGGTAGGGGG + Intergenic
1165099552 19:33430867-33430889 AGCTCTGTGTGCGTGGCAGACGG - Intronic
1165778960 19:38421054-38421076 AGCTATGGGTGGAGGGCAGAGGG - Intronic
1165784836 19:38455300-38455322 TGCTGAGTTTGCAGGGGAGGAGG + Exonic
1166258316 19:41620968-41620990 GGCTGTGTGTGCAGGACACTGGG + Intronic
1166329843 19:42071429-42071451 AGCTGTGTGTTCGAGGCATGCGG - Intronic
1166355641 19:42225723-42225745 AGCACTGTGGGCAGGGCAGCTGG - Exonic
1166856238 19:45783872-45783894 AGTTGAGTGGGCAGGGCCGGGGG - Exonic
1166944801 19:46390263-46390285 GGCTGTGGGACCAGGGCAGGTGG - Exonic
1167220758 19:48196722-48196744 AGAGGTGTCTGCAGGGCAGACGG - Intronic
1167637067 19:50661484-50661506 AGCTGTGTGTGCTGGGGAGAGGG + Intronic
1168121025 19:54252593-54252615 AGTTGTGTGTGCAGGGCAGCTGG - Intronic
1168124603 19:54276500-54276522 AGCTGTGTGTGCAGGGCAGGGGG - Intronic
1168168473 19:54571416-54571438 AGTTCTCTGTGCAGGGCAGGTGG + Intergenic
1168177384 19:54635038-54635060 AGCTGTGTGTGCAGGGCAGGGGG + Intronic
1202702442 1_KI270712v1_random:174720-174742 AGCAGTGTCTGGACGGCAGGTGG - Intergenic
925040369 2:728221-728243 ACCTGTGTGTGCAGGGGTGTAGG + Intergenic
925171207 2:1751269-1751291 GGCAGTGTGTGCAGAGAAGGGGG - Intergenic
925186608 2:1850937-1850959 AGCGGGGTGGGCAGGGCAAGAGG - Intronic
925196566 2:1930626-1930648 AGCTGTGAGTACAGGTGAGGAGG + Intronic
925218406 2:2117074-2117096 AGCTGTGGGTGCTCTGCAGGGGG - Intronic
925342279 2:3145877-3145899 AGCTCTGTGTGAAGGACAGGCGG - Intergenic
925577023 2:5370563-5370585 TGCTGTGTGGGCTGGGCATGGGG + Intergenic
926761786 2:16284592-16284614 AGCTGTTTGTTCTGGGCTGGTGG + Intergenic
927085200 2:19668397-19668419 GGATGTGTTTGCAGGACAGGAGG + Intergenic
927487036 2:23495649-23495671 AGCTGTGGGTACAGTGGAGGTGG - Intronic
927637602 2:24827505-24827527 GGCTGTGAGTGCAGGCCAGGAGG + Intronic
927961479 2:27242970-27242992 AGCTGTGAGTGCTGGGCTTGAGG + Exonic
927971384 2:27307900-27307922 CCCTGTGTGTCCAGGGCCGGCGG - Exonic
929879985 2:45827114-45827136 AGCAGAGTGTGGAGGGCAGTTGG - Intronic
930063590 2:47310811-47310833 AGCTGTGAGTGCAGGGTGAGGGG + Intergenic
930851511 2:55965936-55965958 AGGTGTGTGTGAAGGGAAGGAGG + Intergenic
932451303 2:71812366-71812388 AGCTATGGGTCCTGGGCAGGTGG + Intergenic
933142551 2:78812161-78812183 AGCTGTGAGCGCAGGGAAAGAGG + Intergenic
933726578 2:85430685-85430707 AGGTGCTTGGGCAGGGCAGGAGG + Intronic
933778079 2:85783851-85783873 GGCTGTGTGTGGGGGGCGGGGGG - Intronic
934656900 2:96121136-96121158 AGCGGGGAGAGCAGGGCAGGAGG - Intergenic
936858734 2:116990966-116990988 AGCTGTGAATGCAGGGCATGAGG + Intergenic
937855364 2:126668534-126668556 AGCTGTGTGTGCATTGTAGTTGG - Intronic
937868069 2:126768766-126768788 AGCTGTGTCTCCAGGAGAGGTGG + Intergenic
937916403 2:127101182-127101204 GGGTGTTTGTGCAGGGCAGGTGG - Intronic
938537198 2:132256658-132256680 AGCAGTGTGTGCAGGGAAGAGGG - Intronic
938650161 2:133374650-133374672 AAGTGCGTGTGTAGGGCAGGGGG + Intronic
939002112 2:136748389-136748411 GGCTGTGAGAGCAGGGCTGGAGG - Intergenic
939110360 2:137999403-137999425 TGGTGTGTGTGGAGGGAAGGAGG - Intronic
939129513 2:138217529-138217551 ATATGTGTGTGGAGGGCAGTGGG - Intergenic
941377363 2:164748023-164748045 AGCTGTGTGTGGTGGGGAGCAGG + Intronic
942066469 2:172276564-172276586 AGCTGTGTTTGGAGTTCAGGAGG + Intergenic
942187777 2:173440628-173440650 TGCAGTATGTGAAGGGCAGGGGG - Intergenic
943276766 2:185876983-185877005 AGCGGTGTCTGCAGCGGAGGAGG - Intergenic
944734061 2:202545208-202545230 AGGTGTGTGGGGAGGGGAGGGGG - Intronic
946123359 2:217536630-217536652 AGCTGGGTGTGCACACCAGGGGG + Intronic
946183065 2:217960469-217960491 AGGGGTGGATGCAGGGCAGGGGG + Intronic
946405903 2:219491958-219491980 GGATGTGTGTACAGGGGAGGTGG - Intronic
947142988 2:227036767-227036789 TGCTGTGGGGGAAGGGCAGGAGG + Intronic
947313050 2:228825170-228825192 TGCTTTGTGTGAAGGTCAGGCGG - Intergenic
947360940 2:229344703-229344725 AGCTTTGTGTGCAGGGTGTGTGG - Intergenic
947672100 2:231944209-231944231 AGCTGTGTGTTTGGGGGAGGGGG + Intergenic
947967543 2:234294202-234294224 AGCTGTGTGGGCAGAGAAGAAGG - Intergenic
948015917 2:234690428-234690450 AGCAGTGTCTGCAGGGAAAGGGG + Intergenic
948290267 2:236819293-236819315 ATGTGAGCGTGCAGGGCAGGTGG + Intergenic
948335224 2:237202130-237202152 AGCTGTGGGTGGATAGCAGGAGG + Intergenic
948407985 2:237737054-237737076 GGCTGTCTGTGCAGGCCTGGGGG - Intronic
948665742 2:239533788-239533810 AGCTGTGTGCAGAGGCCAGGAGG - Intergenic
948710535 2:239822308-239822330 AGCTGAGAGTGAGGGGCAGGTGG + Intergenic
949052640 2:241905318-241905340 AGGTGTGTGTGCAGGGCTGTGGG + Intergenic
1168974174 20:1951767-1951789 GGCTGTGTGAGCTGGGCAGGAGG - Intergenic
1169274398 20:4223943-4223965 AGCTGTGTGTGCATGTAGGGTGG + Intronic
1169297771 20:4414851-4414873 AGCTGGGGGAGCGGGGCAGGGGG - Intergenic
1170245881 20:14220804-14220826 GGCTGTGTGTTCAGGAGAGGAGG + Intronic
1171191601 20:23163059-23163081 AGCTGTCTGAGGAGAGCAGGAGG + Intergenic
1171294774 20:24007994-24008016 AGCAGTGTCTGCAGGGCTGTGGG - Intergenic
1171794844 20:29558748-29558770 GGCTGTGTCTGAAGGGCAGCAGG - Intergenic
1171853612 20:30325517-30325539 GGCTGTGTCTGAAGGGCAGCAGG + Intergenic
1171936917 20:31283523-31283545 ATCTGAGGGTGGAGGGCAGGAGG + Intergenic
1172061095 20:32188139-32188161 AGCTGTGGGTGCTGGGGAGGGGG - Intergenic
1172107426 20:32525012-32525034 AGCTCTGTGTGCAGCTCAGCTGG + Intronic
1172636309 20:36412262-36412284 AGCTCTGACTGCAGGGCAGGCGG - Intronic
1172944797 20:38678840-38678862 TGCTCTGGGTGCAGGGGAGGTGG - Intergenic
1174076775 20:47942843-47942865 CGCTGTGTGTCGAGGGCATGTGG + Intergenic
1174428287 20:50448873-50448895 GGCGGCGTGTGCAGGGCAGAGGG - Intergenic
1174893792 20:54427314-54427336 AGCTTTATGTGTAGGGGAGGGGG - Intergenic
1175224952 20:57439386-57439408 AGCTGGGGGTGCAGGGCAGAGGG - Intergenic
1175258910 20:57662896-57662918 AGCTGGGGCTGCAGGGCCGGTGG + Intronic
1175495014 20:59408253-59408275 ACCTCTGGGGGCAGGGCAGGGGG - Intergenic
1175619715 20:60433261-60433283 AACTGTGTCTGCCTGGCAGGGGG + Intergenic
1175719976 20:61280022-61280044 AGCTGTGTGGGTGGGGCAGGCGG + Intronic
1175942222 20:62542735-62542757 AGCTGTGTGTGAAGTGCCCGTGG - Intergenic
1175988472 20:62776120-62776142 AGCTGTGGGTGCTGGGCAGGTGG - Intergenic
1176199864 20:63855358-63855380 AGCTGTGGCCGCAGGGCAGTGGG + Intergenic
1176295433 21:5069640-5069662 AGCTGTGTGTCCAGGGAAGAAGG + Intergenic
1177113487 21:17057453-17057475 AGCTTTGGGTGCATGGCAAGAGG - Intergenic
1177775403 21:25561426-25561448 AGATGGGAGTGGAGGGCAGGGGG + Intergenic
1178286520 21:31329946-31329968 GGCTGTGCGTGTGGGGCAGGAGG - Intronic
1179838560 21:44054846-44054868 AGCAGTGTGGGCAGAGCAGTTGG + Intronic
1179861617 21:44192484-44192506 AGCTGTGTGTCCAGGGAAGAAGG - Intergenic
1180135570 21:45859827-45859849 AGCTGAGGAAGCAGGGCAGGCGG + Intronic
1180187430 21:46146420-46146442 ACCTGTGTGCTCGGGGCAGGGGG - Intronic
1180192410 21:46172278-46172300 AGGGGTGTGTGCAGAGCACGAGG + Intronic
1180230698 21:46425318-46425340 AGCTGCCTGTGCTGGGCACGGGG - Intronic
1180312815 22:11253311-11253333 AGCAGTGCGTGCAGGGAAGAGGG - Intergenic
1180857329 22:19056808-19056830 AGCTCTGTGACCAGGGCAGCTGG - Intronic
1181433225 22:22895354-22895376 ACCTGTGTGGACAGGGAAGGGGG - Exonic
1181516717 22:23418307-23418329 AGCTGTGGGAGCAGAGCAGAGGG - Intergenic
1181573613 22:23780803-23780825 AGCTGGATGTCCTGGGCAGGAGG + Intronic
1182758363 22:32699520-32699542 TGGTGTGTGTGCAGGGATGGGGG + Intronic
1183224006 22:36536866-36536888 AGCTGTGTGGGCAGGTCACATGG - Intergenic
1183347058 22:37313717-37313739 AGCTGGGTGCCCAGGCCAGGGGG - Exonic
1183474658 22:38029483-38029505 ATCAGTGTGTGCAGGGCACAGGG + Intronic
1183693574 22:39405602-39405624 ATCAGTGTGTGCAGGGGTGGAGG + Intronic
1183928049 22:41219886-41219908 AGCCGTGTGTGGTGGCCAGGTGG - Intronic
1184114610 22:42415253-42415275 AGGTGTAGGTGCAGGGGAGGTGG - Intronic
1184115382 22:42418883-42418905 TGTGGTGTGTGCAGGGCTGGGGG + Intronic
1184293531 22:43510209-43510231 AGGGAGGTGTGCAGGGCAGGGGG + Intergenic
1184320193 22:43735734-43735756 AGGTGTGTGTGTGTGGCAGGGGG + Intronic
1184489328 22:44800018-44800040 AGCTGTGTCTGCAGGCACGGAGG + Intronic
1184501107 22:44872633-44872655 AGCAGTATGTGCAGGGCACAGGG + Intergenic
1184501690 22:44878608-44878630 GGCTGGCTGTCCAGGGCAGGCGG - Intergenic
1184765621 22:46570545-46570567 AGCTCTGGGCACAGGGCAGGTGG - Intergenic
1184926889 22:47648603-47648625 AGCTGTGTATGCAGTGGATGAGG + Intergenic
1185045921 22:48528742-48528764 AAGTGTGCGTGCAGGGCCGGTGG + Intronic
1185118735 22:48952949-48952971 AGCCGTGTGTCCAGTGCAAGGGG - Intergenic
1185149486 22:49155858-49155880 AATTGTGTGTGCAGAGCGGGAGG - Intergenic
1185149497 22:49155922-49155944 AATTGTGTGTGCAGAGCGGGAGG - Intergenic
1185149519 22:49156050-49156072 AATTGTGTGTGCAGAGCGGGAGG - Intergenic
1185219522 22:49622469-49622491 GGCGGTGTGGGCAGGGCTGGCGG + Intronic
1185416888 22:50715458-50715480 GGCTGTGTGGGCAGTGCAGATGG - Intergenic
950215663 3:11156394-11156416 AGCTGAGTGTCCAAGGGAGGAGG + Intronic
950553591 3:13682224-13682246 CGCTGTGTGGTCCGGGCAGGAGG + Intergenic
950650878 3:14405933-14405955 AGCTGAGTGTGCAGTGAGGGTGG + Intronic
950955424 3:17047764-17047786 TGCTGTGTGTGCAGGTTAAGGGG - Intronic
952526736 3:34218481-34218503 GGCGGTGAGAGCAGGGCAGGTGG - Intergenic
952543686 3:34395858-34395880 AGCAGTGGGTGCAGTGCAGTGGG + Intergenic
952923755 3:38307005-38307027 AGATGTGTGTGTGGGGTAGGGGG - Intronic
953980507 3:47410829-47410851 AGCTGGGTGTGTAGGGGGGGTGG - Exonic
954104612 3:48403276-48403298 AGTTGGGTCTGTAGGGCAGGGGG - Intergenic
954333421 3:49902771-49902793 AGGCGTGTGTGCAGGGCACTAGG + Exonic
954419164 3:50409502-50409524 AGCTCCGTGTGCAGCACAGGCGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957016510 3:75070084-75070106 AGGTGTGTGTTCTGGGAAGGAGG + Intergenic
958001400 3:87753839-87753861 AGCACTGTGTGCAGGGAAGAAGG + Intergenic
958162183 3:89831843-89831865 AGCAGTGGGTGCAGGACAGTGGG + Intergenic
960594501 3:119395771-119395793 AGCTATGTGCGAAGGGCAGAAGG + Intronic
961591395 3:127984401-127984423 AGCAGTGTGTGCTGGGCACTGGG + Exonic
962155547 3:132945254-132945276 AGCTGTGTGTGTTGGGGGGGTGG + Intergenic
962560661 3:136603000-136603022 ATTTGTGTGGGCAGGGAAGGAGG - Intronic
962805986 3:138928277-138928299 AGGTGTGTGTGGAAGGCATGCGG + Intergenic
962865144 3:139442387-139442409 GGATCTGTGTGCAGGGCTGGGGG - Intergenic
964807962 3:160632061-160632083 GGATATATGTGCAGGGCAGGGGG - Intergenic
965366741 3:167810048-167810070 ATGTGTGTGTGCATGGCATGGGG - Intronic
965401024 3:168212661-168212683 AGATGTGTGTGCATGGGGGGAGG + Intergenic
965694654 3:171394903-171394925 AGCTGTGTGTGTGTTGCAGGGGG + Intronic
966881611 3:184354054-184354076 GGCTGTGGGTGAAGGGCAGAGGG - Intronic
967457887 3:189710809-189710831 AGCTGTGTAAGAAGAGCAGGAGG - Intronic
968121245 3:196127683-196127705 GGCTGACCGTGCAGGGCAGGGGG + Intergenic
968550911 4:1222984-1223006 ACCTGTGGCTGCAGGACAGGCGG + Intronic
968684987 4:1952087-1952109 AGCTGCGGGGGCAGAGCAGGCGG - Exonic
968818736 4:2834843-2834865 AGCTGGGTGTGCAGGGACTGGGG + Exonic
969276770 4:6141049-6141071 CGCTGTGAATGCTGGGCAGGGGG - Intronic
969593421 4:8134434-8134456 AGCTGTGTGTGGAGGGGCTGTGG - Intronic
969635929 4:8369582-8369604 AGCCGGGTGGGCAGGGCAGGAGG - Intronic
969642839 4:8409504-8409526 AGCTGTCTGTGCACTGCGGGTGG + Intronic
969897779 4:10321281-10321303 AGCTGTCTGAGCGGGGGAGGGGG + Intergenic
970498567 4:16653286-16653308 ACCTGCTTGTGCAGGGCTGGCGG - Intronic
971082193 4:23226464-23226486 AGATGTGTGTCCAGGGCAGAAGG + Intergenic
971110777 4:23583172-23583194 AGGTGTGTGTGCAGGTTTGGAGG - Intergenic
971247007 4:24938537-24938559 CGCAGTGGGTGCAGGACAGGGGG + Intronic
971713001 4:30141319-30141341 TGTTGTGTGTGTGGGGCAGGGGG + Intergenic
973956099 4:56064985-56065007 AGCTGTGGTTGCAGGGCAGTGGG + Intergenic
973960255 4:56102748-56102770 AGCAGAGTGTGAAGAGCAGGAGG - Intergenic
974515248 4:62899453-62899475 AGCTGTGTGTTCAGGACACAAGG + Intergenic
976402080 4:84618778-84618800 ACCAGTGTGTGCAGGGCAGTGGG + Intronic
977194507 4:94042865-94042887 AGCTGTATGAACAGGGGAGGAGG - Intergenic
977826926 4:101543576-101543598 GGGTGTGTGTTGAGGGCAGGGGG + Intronic
978184101 4:105836658-105836680 AGCTGTGTGTGCACTCAAGGTGG - Intronic
978445917 4:108779780-108779802 AGCTGGCTCTGCAGGGAAGGAGG + Intergenic
982082719 4:151806203-151806225 AGCTGTGCTTGCAGGAGAGGGGG + Intergenic
982380438 4:154743133-154743155 GGGTGTGTGTGTAGGGCGGGGGG - Intronic
982682849 4:158452860-158452882 AGGGTTGTGGGCAGGGCAGGGGG - Intronic
984034555 4:174649265-174649287 AGCTGCTTGAGCAGGGAAGGAGG + Intronic
984864545 4:184270469-184270491 AGGTGTGTGTTCAGGGAAGGAGG - Intergenic
985516001 5:344908-344930 AGGTGTGTGTGGAGGGCTGTGGG + Intronic
985525925 5:401590-401612 AGCTGTGAAGCCAGGGCAGGCGG + Intronic
985576368 5:675227-675249 GGCTGGGGGTGCAGTGCAGGGGG + Intronic
985589293 5:756441-756463 GGCTGTGTGTGCAGGGCCGATGG - Intronic
985604010 5:849105-849127 GGCTGTGTGTGCAGGGCCGACGG - Intronic
985659990 5:1152229-1152251 GGCCGGGTGTGCAGGGCAGAGGG - Intergenic
985778119 5:1855819-1855841 GGCTGTAAGTGCAGGGCAAGCGG - Intergenic
986423416 5:7606983-7607005 CCCTGCATGTGCAGGGCAGGTGG - Intronic
987215651 5:15734181-15734203 AGCTGTGTGCTCAGCGCAGCTGG - Intronic
990779210 5:59339435-59339457 AGATGCATGTGCAGGGGAGGAGG + Intronic
991573370 5:68078215-68078237 AGCTGTTGCTGCAAGGCAGGAGG - Intergenic
991573504 5:68079508-68079530 AACTTGGTGGGCAGGGCAGGGGG + Intergenic
991610409 5:68443755-68443777 TGCAGTGTGTGCAGAGCAGTGGG - Intergenic
992529376 5:77640359-77640381 ACGTGTGTGTGCAGGAGAGGAGG - Intergenic
992877762 5:81074828-81074850 AGCTGTGCGTGCAGGGGACATGG + Intronic
993883985 5:93395357-93395379 AGCTGTGTGTTCAGTACAGGAGG + Intergenic
994177724 5:96729984-96730006 AGCTGTGACTGCAGGGCAGCAGG + Intronic
995210338 5:109530616-109530638 GGCTGTCTGTGGAGGGCTGGAGG - Intergenic
996126551 5:119731997-119732019 AGCCGTGAGAGCAGGGCTGGAGG + Intergenic
996423264 5:123285654-123285676 AGGGGTGGGTGGAGGGCAGGAGG - Intergenic
997614974 5:135240100-135240122 GGCTGTGTGGGCGGGGCTGGAGG - Intronic
998109890 5:139493083-139493105 TGATGTGTGTGCAGAGCAGCAGG + Intergenic
998940818 5:147280398-147280420 AGCTGTGTTGGCGGGGGAGGGGG + Intronic
1000832005 5:166114021-166114043 TTGTGTGTGTGCATGGCAGGTGG + Intergenic
1001057359 5:168460799-168460821 AGATGTGTGTGCAGGACACAGGG - Intronic
1001068395 5:168559484-168559506 GGCTGTGTGTGTATGGAAGGTGG + Intronic
1001300860 5:170532741-170532763 AGCTGAGTGTCCAGGGCAGGGGG - Intronic
1001634786 5:173202028-173202050 AGCTGTGTGGCCAGGGCCGTAGG - Intergenic
1002051440 5:176573878-176573900 GGCTGTGTGGGGAGGGGAGGAGG + Intronic
1002398011 5:178972782-178972804 AGATGTGGGGGAAGGGCAGGCGG + Intergenic
1002810453 6:623108-623130 AGCTGGGAGTGCAGGGCCAGTGG - Intronic
1003487974 6:6595879-6595901 AGCAGTGTGTGGAGGGCTGTGGG + Intronic
1003761429 6:9182732-9182754 ATATGTGTGAGGAGGGCAGGGGG + Intergenic
1004116963 6:12778892-12778914 GGCTGTGTCTGCAGGGGAGGGGG - Intronic
1004505868 6:16246257-16246279 AGCTGGGTGGGGAGGTCAGGGGG - Intronic
1004558871 6:16728259-16728281 AGCTGTGCGCACAGGGCAGTGGG + Intronic
1004634285 6:17452101-17452123 GACTGTGTGTGTAGGGCAAGTGG + Intronic
1004916829 6:20340333-20340355 AGCAGTGTGGGCAGCGCAGTAGG + Intergenic
1006155124 6:32009677-32009699 AGGGGTCTGTGCAGGGCAAGGGG - Intergenic
1007415482 6:41688982-41689004 AGGTGTGTACGCTGGGCAGGTGG - Intronic
1008521715 6:52367892-52367914 TGCTGTGTGAGCAGGTGAGGAGG + Intronic
1008951805 6:57169944-57169966 AGATGTGGGGGCAGGGCAAGAGG + Exonic
1009431647 6:63572623-63572645 GGCGGTGGCTGCAGGGCAGGAGG - Exonic
1011055396 6:83198558-83198580 AGCTGTGTGTGTAGGGGGAGGGG - Exonic
1015152714 6:130056541-130056563 AGCTGTGTGCCTAGGGCAGGTGG - Intronic
1015534109 6:134249626-134249648 GGCTGTGTTTCCAGGACAGGGGG - Intronic
1015826569 6:137318754-137318776 AGCTGGGTGTGCAGGCCTGCAGG + Intergenic
1016181540 6:141153624-141153646 AGGGGTGTTTGCAGGGTAGGGGG - Intergenic
1016848889 6:148596304-148596326 AGTTGTGAGTGCAGGGGAGTAGG - Intergenic
1017043276 6:150324791-150324813 AGAGGTGTGGGCAGGCCAGGAGG + Intergenic
1017884688 6:158588955-158588977 GGCTCTGTGTGCATGGCTGGTGG + Intronic
1018394955 6:163370968-163370990 CCCTGTGTGGGCAGGACAGGAGG - Intergenic
1018419232 6:163627821-163627843 AACTCCGTGTGCAGGGCGGGTGG + Intergenic
1019046726 6:169155433-169155455 TGCAGGGTGAGCAGGGCAGGTGG + Intergenic
1019117596 6:169777772-169777794 AGCTGTGGGTGGGGGGAAGGGGG - Intronic
1019134253 6:169898253-169898275 AGGTGTCTGTGCAGGGCCGAGGG - Intergenic
1019407733 7:892580-892602 AGGTGTGTGTGCAGGTCTGTTGG + Intronic
1019622269 7:1998379-1998401 AGCTGCAGGTGCCGGGCAGGTGG + Intronic
1019726561 7:2606067-2606089 AGCACTGGGTGCAGGGCATGTGG + Intronic
1020749829 7:12126382-12126404 AGCTCTGTGAGCAGGGCAGATGG - Intergenic
1020845353 7:13274686-13274708 GGCAGTGTGTGCAGGACAGTAGG - Intergenic
1020968709 7:14905846-14905868 ATCTGTGAGTGCAGGGCATTGGG + Intronic
1021261495 7:18463360-18463382 AGGTGTGTGTGTGGGGCAAGGGG + Intronic
1021530096 7:21634657-21634679 AGTTGAGAGTGGAGGGCAGGAGG + Intronic
1022734301 7:33062207-33062229 AGCTGCATGTCCTGGGCAGGTGG - Intronic
1022983020 7:35622616-35622638 AGCTCAGTGTGGAAGGCAGGTGG + Intergenic
1023837649 7:44077732-44077754 AGCAGTGTGTGCAGGGCAAATGG - Intronic
1023881953 7:44325712-44325734 AGCAGCGTGTGCAGGGCGCGGGG - Intronic
1024004185 7:45213160-45213182 TGCTGTGTGTGCGGTGAAGGGGG + Intergenic
1024261425 7:47576708-47576730 ATCTGGCTGTGCAGGGCAGGCGG - Intronic
1024512272 7:50213319-50213341 AGCAGGGTGTACATGGCAGGGGG + Intergenic
1026440328 7:70438394-70438416 GGCTGGGGGTGCAGGGCAGGAGG - Intronic
1026912055 7:74096768-74096790 AGGTGAGTGTGCAAGGCAGGGGG - Intronic
1027532947 7:79358200-79358222 ACCTGTGTGTGCAGGGGTAGGGG - Intronic
1029117621 7:98245310-98245332 GGCGCTGTGAGCAGGGCAGGCGG + Intronic
1029127287 7:98303374-98303396 ACCTGTGGGTGAAGGGGAGGAGG - Intronic
1029403621 7:100360050-100360072 AGCTGTGTGGAGAGGGCTGGGGG - Intronic
1030640360 7:111998246-111998268 ATCTGTGTGTGCTGGACAAGAGG - Intronic
1031813432 7:126401712-126401734 AGGTGTATGTGAAAGGCAGGGGG + Intergenic
1032153688 7:129451379-129451401 GGCTGTGTGTGGAGGACAGAGGG + Intronic
1032440015 7:131935404-131935426 CTCTGTGTGGGCAGGGCATGAGG + Intergenic
1032506645 7:132440199-132440221 ATATGTCTGTGCAAGGCAGGGGG - Intronic
1033027387 7:137788688-137788710 ATGTGTGTGTGTATGGCAGGGGG - Intronic
1034131718 7:148724688-148724710 ACCTGTGTGTCCAAGTCAGGAGG + Intronic
1034161037 7:148994522-148994544 AGCTGGGTGTGAAGGTCAGAGGG - Intergenic
1034235097 7:149560574-149560596 TGATGAGTGTGCAGAGCAGGGGG + Intergenic
1034365086 7:150539455-150539477 AGATTTGTGTGTGGGGCAGGGGG - Intergenic
1034971046 7:155419254-155419276 AGCTCTGTGTGCAGGGAGAGTGG + Intergenic
1035438602 7:158878214-158878236 TGCTGTGTGGGGAGGCCAGGAGG + Intronic
1035527499 8:325296-325318 AGCTGGGTGTGGAGATCAGGGGG - Intergenic
1035586659 8:780676-780698 AGCTCAGTCTGCAGGGCAGGAGG + Intergenic
1036165714 8:6430965-6430987 AGGTGTGTCCACAGGGCAGGAGG + Intronic
1036649006 8:10630175-10630197 AGCTGGGAGTGCAGTGGAGGGGG + Intronic
1036664710 8:10730786-10730808 ACCTGCGGGTCCAGGGCAGGGGG - Intronic
1036695992 8:10975510-10975532 AGCCGTGTGCCCAGGGCAGGTGG - Intronic
1037502243 8:19497182-19497204 AACTGTCTGTGCAGGGCAGGAGG - Intronic
1037696869 8:21231061-21231083 AGGAGTGTGTGCAGTGGAGGTGG - Intergenic
1037814526 8:22104911-22104933 AGATGTGTGTGGAGGGGTGGGGG + Intergenic
1037888560 8:22608540-22608562 ACCTGTGTGTCCAAGGCACGGGG - Intronic
1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG + Intronic
1038813842 8:30880780-30880802 AGCTGTGTGTTTTGGGGAGGGGG + Intronic
1040046286 8:42967258-42967280 AGGTGTGTGTGGAGGGCAGCCGG - Intronic
1040073959 8:43211059-43211081 AGCTCTGGGTGCAGGGTAGGTGG + Intergenic
1040913587 8:52545504-52545526 AGGGGTGTGTGCAGGGAGGGAGG - Intronic
1041429491 8:57763017-57763039 AGCTGTGTGTCCAGACCAGGAGG + Intergenic
1041941569 8:63393854-63393876 GGCTGTGCGTATAGGGCAGGGGG - Intergenic
1042164541 8:65933094-65933116 AGCTGTGTGTGCATGCATGGGGG + Intergenic
1042422299 8:68605952-68605974 TGGTGTGTGTGGGGGGCAGGAGG + Intronic
1042524765 8:69752764-69752786 AGCTGTGTGTCCCAGTCAGGAGG + Intronic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1043130594 8:76456080-76456102 GACTGTGTGCGGAGGGCAGGGGG - Intergenic
1043454846 8:80402863-80402885 ACCTGTGGCTGCAGGGCAGTAGG - Intergenic
1044045987 8:87432848-87432870 AGATGTCTGTGCAGGGCAACAGG - Intronic
1044618088 8:94162827-94162849 AGATGTGTGTGGAGTGCAGGTGG + Intronic
1044690667 8:94874439-94874461 AGCTGTGTGTGGAGGAACGGGGG - Intronic
1044874402 8:96650156-96650178 AGGTGTGGGTGCTGGGCAGAGGG + Intronic
1047229631 8:122985500-122985522 AGCTGTCTTTCCAGAGCAGGTGG - Intergenic
1048073422 8:131042754-131042776 AATTCTGTGTGCAAGGCAGGTGG - Intergenic
1048209678 8:132444268-132444290 GGCTGGGTGAGGAGGGCAGGAGG - Intronic
1049069164 8:140343890-140343912 AGCTGAGTGTGGAGGGCAGAGGG + Intronic
1049319680 8:141989446-141989468 AGCTGTCTGTGCTGGGAAGAGGG + Intergenic
1049446883 8:142635282-142635304 AGCAGTGTGCCCAGGGCAGTAGG + Intergenic
1049457168 8:142699386-142699408 GGCTTTCTGTGCAGGGCAGGGGG + Intergenic
1049584759 8:143427787-143427809 GGCTGGGGGTGCAGGGCAGGAGG - Intronic
1050883877 9:10739438-10739460 AACTGTGTGTGCAGAGAAAGGGG - Intergenic
1051726550 9:20092721-20092743 ATTTGTGTGTGCAGGGCAGGGGG + Intergenic
1052532525 9:29706120-29706142 ATGTGTGTGCTCAGGGCAGGCGG + Intergenic
1053186895 9:36023837-36023859 AGATGTGGGACCAGGGCAGGAGG + Intergenic
1053428148 9:38024591-38024613 AGCTGTGGGTCCTGGGTAGGAGG + Intronic
1054681091 9:67919642-67919664 AGCGGTGTGTGGAAGGCAGAAGG + Intergenic
1056762609 9:89425872-89425894 AGCTGTTGGCTCAGGGCAGGTGG - Intronic
1056765153 9:89440506-89440528 GGCTGAGTGTGGAGGGCAAGCGG - Intronic
1057229187 9:93308581-93308603 GGCTGTGAGTGCGGGGCGGGTGG + Exonic
1057483343 9:95462814-95462836 AGCTGTGTGTGGTGTGCTGGCGG - Intronic
1057879886 9:98785412-98785434 AGCTGTGTCTGCAGGTTTGGAGG - Intronic
1058132114 9:101264942-101264964 GCCTGTGTGTCCAGGGCAGTAGG - Intronic
1059350487 9:113660967-113660989 AACTGTGTGTGCAGATCAGAAGG + Intergenic
1059408671 9:114118359-114118381 AAGTGTGTGTGCAGGGGAGGGGG - Intergenic
1060087027 9:120713274-120713296 AGATGTGTGTGTATGACAGGTGG - Intronic
1060110376 9:120902488-120902510 TGCTCTGTGGGCAGGGCGGGGGG + Exonic
1061002246 9:127908960-127908982 AGGTGGGCGTGCAGGGCTGGTGG - Intronic
1061462558 9:130751896-130751918 AACTGTAGGTGCAGGGGAGGTGG + Intronic
1061488456 9:130932503-130932525 AGCAGTTTGTGCAGAGCTGGTGG - Intronic
1061626605 9:131844159-131844181 TGCTGTGGGTGCAGGGCCTGTGG + Intergenic
1061809734 9:133155301-133155323 AGCTGTGTGGGCCTGGCAGCAGG + Exonic
1062273535 9:135720485-135720507 AGCTGGGAGGGCTGGGCAGGAGG - Intronic
1062401219 9:136373550-136373572 TGGTGTGTCTGCAGTGCAGGTGG - Exonic
1062444184 9:136586830-136586852 CTCTGTGTGTGCAGGGCAAGAGG + Intergenic
1062459816 9:136658333-136658355 AGCAGTGTGTGCAGAACTGGGGG + Intergenic
1062658756 9:137617711-137617733 AGAGGTGGGTGCGGGGCAGGAGG + Intronic
1203360415 Un_KI270442v1:216621-216643 AGCGATGCGTGCTGGGCAGGCGG + Intergenic
1185644010 X:1604212-1604234 AGCTGTGTGCGCAAGACAGAAGG + Intergenic
1186257628 X:7739941-7739963 AGCTGTGTGACCAGGGCACCTGG - Intergenic
1187222170 X:17338693-17338715 AGCTGTGTGTGGAGCACAGGGGG + Intergenic
1187481056 X:19656062-19656084 AGGTATGTGTGCAGGGAATGGGG + Intronic
1190078587 X:47337239-47337261 AGGTGTGGGGGCAGTGCAGGTGG + Intergenic
1190255046 X:48756028-48756050 AGCTGTGTGCACAAGGCTGGTGG + Intergenic
1190744813 X:53316172-53316194 GGCTGTGTGCACAGCGCAGGAGG - Intronic
1190944184 X:55075026-55075048 AGCTGTGTGTGGACAGAAGGCGG - Intergenic
1192370893 X:70512095-70512117 AGCTTTGTGTGAGGGGCAGTGGG - Intergenic
1192914623 X:75638862-75638884 AGCTGTGTGTTCAGGAGAGGAGG + Intergenic
1193583581 X:83294107-83294129 AGCTTTGGGTGCAGGTCATGGGG - Intergenic
1194657994 X:96597004-96597026 AGGTGTGTGTGCAGGGAAGGGGG - Intergenic
1195452021 X:105025835-105025857 AGCTGTTTCTGCAGTCCAGGTGG + Intronic
1197323354 X:125061588-125061610 AGCTGTATGTGCAGAAGAGGAGG + Intergenic
1198040123 X:132842600-132842622 ATCTGTCTATTCAGGGCAGGGGG - Intronic
1199731053 X:150632547-150632569 TGCAGTGTGTGCAGAGTAGGTGG + Intronic
1200110222 X:153737143-153737165 TGCTGTCTCTGCAGGCCAGGTGG + Exonic
1200114936 X:153765851-153765873 ATCTCTCTGTGGAGGGCAGGAGG + Intronic
1200123062 X:153800354-153800376 AGCAGCCTGTGCAGGGCGGGTGG + Intergenic
1200871402 Y:8102432-8102454 GGCTGTGGGTGCAGGACAGTGGG - Intergenic
1201491531 Y:14547209-14547231 ACTTATGTGTGCTGGGCAGGAGG + Intronic
1201614426 Y:15881501-15881523 AGGTGTGTGTTCAGGAGAGGAGG + Intergenic
1201615942 Y:15898274-15898296 AGGTGTGTGTTCAGGAGAGGAGG - Intergenic