ID: 1168181771

View in Genome Browser
Species Human (GRCh38)
Location 19:54666603-54666625
Sequence CAGTGGCACTAATGGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 126}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168181763_1168181771 -8 Left 1168181763 19:54666588-54666610 CCCCTCCCTGCGTTGCAGTGGCA 0: 1
1: 0
2: 1
3: 16
4: 162
Right 1168181771 19:54666603-54666625 CAGTGGCACTAATGGGAACAGGG 0: 1
1: 0
2: 0
3: 12
4: 126
1168181760_1168181771 22 Left 1168181760 19:54666558-54666580 CCACATTGTGGGACCTCGGGGAC 0: 1
1: 1
2: 2
3: 4
4: 69
Right 1168181771 19:54666603-54666625 CAGTGGCACTAATGGGAACAGGG 0: 1
1: 0
2: 0
3: 12
4: 126
1168181761_1168181771 9 Left 1168181761 19:54666571-54666593 CCTCGGGGACATCACAGCCCCTC 0: 1
1: 1
2: 3
3: 21
4: 235
Right 1168181771 19:54666603-54666625 CAGTGGCACTAATGGGAACAGGG 0: 1
1: 0
2: 0
3: 12
4: 126
1168181765_1168181771 -10 Left 1168181765 19:54666590-54666612 CCTCCCTGCGTTGCAGTGGCACT 0: 1
1: 0
2: 0
3: 20
4: 432
Right 1168181771 19:54666603-54666625 CAGTGGCACTAATGGGAACAGGG 0: 1
1: 0
2: 0
3: 12
4: 126
1168181759_1168181771 23 Left 1168181759 19:54666557-54666579 CCCACATTGTGGGACCTCGGGGA 0: 1
1: 0
2: 3
3: 4
4: 73
Right 1168181771 19:54666603-54666625 CAGTGGCACTAATGGGAACAGGG 0: 1
1: 0
2: 0
3: 12
4: 126
1168181764_1168181771 -9 Left 1168181764 19:54666589-54666611 CCCTCCCTGCGTTGCAGTGGCAC 0: 1
1: 0
2: 2
3: 16
4: 307
Right 1168181771 19:54666603-54666625 CAGTGGCACTAATGGGAACAGGG 0: 1
1: 0
2: 0
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168181771 Original CRISPR CAGTGGCACTAATGGGAACA GGG Intronic
901187545 1:7384881-7384903 CAGTGGCGCTGACGGGTACAGGG - Intronic
903756285 1:25663664-25663686 CAGTGGGACGAATGGGGAGATGG + Intronic
906254816 1:44340090-44340112 ATGTGGCAGTAATAGGAACATGG + Intronic
906542126 1:46595100-46595122 AGGTGGCATGAATGGGAACAAGG + Intronic
906812696 1:48845263-48845285 CCATGGCTCTAATCGGAACAAGG + Intronic
907390148 1:54152866-54152888 CAGTGGCACTGCTGGGCCCAGGG - Exonic
911930769 1:103900622-103900644 TAGCGGCACTAATGGAACCAGGG - Intergenic
912108172 1:106306755-106306777 CAGTGGCAATGATGGTAATAAGG - Intergenic
916752177 1:167733296-167733318 CAGTGGGAATAATTGGATCATGG - Intronic
917978727 1:180256333-180256355 CACTGGCTCTAATGGGACCCTGG - Intronic
924085457 1:240446916-240446938 CACTCCCCCTAATGGGAACAGGG - Intronic
1068030777 10:51702241-51702263 CAGTGGGACTAAAGAGAACATGG - Intronic
1068555335 10:58452605-58452627 CAGTTGCAATACTGGGAAGAGGG + Intergenic
1068796447 10:61086430-61086452 CTTTGGAACTAATGAGAACAAGG - Intergenic
1068937634 10:62651461-62651483 CAGTGGCAGTATTTGGCACAGGG - Intronic
1069080345 10:64081903-64081925 CAGAGGCCCTACTGGGAACTAGG + Intergenic
1069454680 10:68544801-68544823 CAAAGGCACTAATGGGAAGAGGG + Intergenic
1071343480 10:84669063-84669085 CAGCTGCACTAATGGGGAAACGG - Intergenic
1072575171 10:96692975-96692997 CAATGGCAGGAATGGCAACAAGG - Intronic
1080805673 11:35651063-35651085 CAGAGGCACTGCTGGGCACAGGG + Intergenic
1081227701 11:40544949-40544971 GACTGTCACTAAAGGGAACATGG - Intronic
1081404755 11:42684072-42684094 CAGTGGTAGTAATGGTAGCAAGG + Intergenic
1082729758 11:56781171-56781193 CAGTGGCAGTAATTGGATCATGG - Intergenic
1083220052 11:61246405-61246427 AAGTGGCACTAAGGGGCAAATGG - Intronic
1084900979 11:72309710-72309732 TGGTTGCACTAATGGAAACACGG + Intronic
1087509300 11:99069842-99069864 CAGTAGCACTGGTGTGAACAGGG - Intronic
1088335280 11:108696799-108696821 CAGTGGTATTGATGGGGACAGGG + Intronic
1089584044 11:119498675-119498697 CAGTGCCACTTCTGGGAGCAAGG - Intergenic
1090199865 11:124846331-124846353 CAGTGGCACTAATAGGGAGGGGG - Intergenic
1090639259 11:128716620-128716642 CAGCGGCTCTGATGGGCACACGG - Intronic
1092035408 12:5330235-5330257 CAGTGTCCCTAAGGGAAACAAGG + Intergenic
1093092416 12:14936630-14936652 AGGTGGCAGTAATGGGATCATGG + Intronic
1095905872 12:47377446-47377468 CAGTGACAGTAATGACAACAAGG + Intergenic
1096652497 12:53068727-53068749 CAGGGGGCCTAATGGGGACAGGG + Intronic
1097951169 12:65429614-65429636 CAGTGGGCCCAGTGGGAACATGG - Intronic
1100938535 12:99698460-99698482 CACTGACACTATTGGGAACTGGG + Intronic
1101418760 12:104531808-104531830 CATTGACAGTAATGGGAAGAAGG - Intronic
1101655465 12:106716332-106716354 CAGTGTCACTATTGGGATCCTGG - Intronic
1109633476 13:65083689-65083711 CAAGGGCAATAATGGAAACAGGG + Intergenic
1110938434 13:81320180-81320202 CAGTGGCACTTATGTTTACATGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112963545 13:105158868-105158890 CAGTGGCCGTAATGGGAATTAGG - Intergenic
1114290504 14:21284359-21284381 CAGTGGCATTTATGGAAATAGGG + Intergenic
1119681998 14:76599413-76599435 CAGTGGCAGTGATGGGACCATGG - Intergenic
1122150346 14:99722154-99722176 CCGTTGCAATGATGGGAACAGGG - Intronic
1129957951 15:79656372-79656394 GAGTGGCACCAATGGGAAGCAGG - Intergenic
1132116949 15:99144314-99144336 CAGTGGCAGCTATGGGATCAGGG + Intronic
1136415158 16:30098386-30098408 CAGTGGTACTTAAGGGAAAAGGG - Intergenic
1136913554 16:34162315-34162337 CAGCGGCAGCAATGGGAACCCGG - Intergenic
1138475455 16:57268306-57268328 CAGTGTCACTCAGGTGAACAAGG - Intronic
1141697931 16:85628949-85628971 CAGTGGCAGTGATTGGATCATGG + Intronic
1144848253 17:18231181-18231203 CAGTGGCAGTCAGGGGAAAAAGG - Intronic
1149699051 17:58639837-58639859 CCGTGGCAGGAAAGGGAACAGGG + Intronic
1150246905 17:63682881-63682903 CATTGGGACTAATTGGAAGAGGG + Intronic
1153002823 18:471990-472012 AAGTAGCACAAATGGGCACAAGG - Intronic
1153917051 18:9755364-9755386 CAAGGGCACTGATGGGAACCTGG - Intronic
1157490246 18:48118376-48118398 CAGTGGCACAAAAGGGGAAAAGG - Intronic
1157816330 18:50731900-50731922 CAGTGGCCTTCATGGGCACAGGG - Intergenic
1159605538 18:70470726-70470748 AACTGCCACTAATGGCAACAAGG + Intergenic
1160545124 18:79648301-79648323 CAGTGGCTGTAATGGAAACCTGG + Intergenic
1161554537 19:4933144-4933166 CAGAGGCACTCAGGGGCACAAGG - Intronic
1163705340 19:18809171-18809193 CTGGGGCGCAAATGGGAACAAGG + Intergenic
1168181771 19:54666603-54666625 CAGTGGCACTAATGGGAACAGGG + Intronic
926581042 2:14633166-14633188 CATTGGCCCTGATGGGGACAAGG + Intronic
932083883 2:68740208-68740230 GAATGGCAGTGATGGGAACAGGG - Intronic
934323518 2:91986254-91986276 CAGTGGCAGGACTAGGAACAGGG - Intergenic
938768219 2:134478063-134478085 CAGTAGCAAGAGTGGGAACAAGG - Intronic
946281099 2:218666013-218666035 CAGTGGAAGTAGTGGTAACAGGG + Exonic
1170927855 20:20742182-20742204 CTGTGGTAATAATGGGCACATGG + Intergenic
1171767448 20:29297872-29297894 CAGTGGCAGCGATGGGAACCCGG + Intergenic
1171865579 20:30485697-30485719 CAGCGGCAGTGATGGGAACCTGG + Intergenic
1174291899 20:49514676-49514698 CAGTGTCAGTAATAGGAACAGGG + Intronic
1174651319 20:52128292-52128314 CAGTGGACCTGATGGGAACAGGG - Intronic
1175759676 20:61553296-61553318 CAGAGACACTAATGGGTGCAGGG + Intronic
1178356467 21:31913675-31913697 CATTGGCACTCATGGGCAGATGG + Intronic
1179194900 21:39155778-39155800 CAGTGGCAAGAATGGCCACAAGG + Intergenic
1181235258 22:21444666-21444688 CATTTGCACTAATGAGAAAATGG - Intronic
1181844415 22:25695104-25695126 TAGTGGCACCCATGGGTACATGG + Exonic
1183309695 22:37102781-37102803 CAGAGGCACTAATTGGTACCAGG + Intronic
1184173768 22:42774609-42774631 CAGTGGCACCCAGGAGAACAGGG - Intergenic
1184749139 22:46474225-46474247 CAGTGGCACAGATGGGGACAAGG - Intronic
951754719 3:26077441-26077463 GGGTGGCACTAATGGGAGAATGG - Intergenic
953460717 3:43079616-43079638 CAGTGGGATTAATGGGCCCAGGG + Exonic
956074237 3:65488054-65488076 CAGTGGTTCTAAGGGAAACAGGG + Intronic
956533191 3:70244119-70244141 CTTTGGCTCAAATGGGAACAAGG + Intergenic
957412432 3:79859001-79859023 CAGTGGCAGTAATGGCTAGAGGG - Intergenic
958636869 3:96755907-96755929 CAGTGGCTCTGCTGGGAATATGG + Intergenic
959357481 3:105351113-105351135 CAGTGGAAGAAATGGGAAAAGGG + Intergenic
961026519 3:123563144-123563166 CAGTGGTACTGGTGGGGACATGG + Intronic
962412433 3:135152894-135152916 CAAGGTCTCTAATGGGAACAGGG + Intronic
965899442 3:173620343-173620365 CTGTGGAAATAATGGAAACAAGG + Intronic
971479284 4:27099778-27099800 CAGTGGCACCAATGAGATCACGG - Intergenic
974542416 4:63254869-63254891 AAGTGGCACTAAGGAGAACTAGG + Intergenic
976646901 4:87396305-87396327 GAGAGGCACGAGTGGGAACAGGG - Intergenic
976712181 4:88084436-88084458 CAGTGGCAACAATGGGGACTAGG - Intergenic
980215253 4:129844519-129844541 AAGTGGTGGTAATGGGAACAAGG - Intergenic
980349707 4:131669405-131669427 CAGTGTCAGAAATGGGACCAAGG - Intergenic
985297816 4:188454623-188454645 CAGAGGGACAAATGAGAACATGG - Intergenic
988974878 5:36505158-36505180 CAGTGGGGGTAAAGGGAACATGG + Intergenic
990980981 5:61602319-61602341 CAGTGGCACTGATGGAATAAGGG + Intergenic
990998139 5:61754137-61754159 CAGTGGCCCTAATGACATCAAGG + Intergenic
994606869 5:101979032-101979054 CATAATCACTAATGGGAACATGG - Intergenic
995408017 5:111824051-111824073 GAGTGGCACTAATGGAAAATGGG + Intronic
995652220 5:114382700-114382722 TTGTGGCACAAATGGGAAAATGG - Intronic
998391564 5:141790154-141790176 AAGAGACACTAGTGGGAACAAGG - Intergenic
1006922608 6:37636570-37636592 CAGTGGGACTCCTGAGAACACGG - Exonic
1009397482 6:63216312-63216334 TAGTTGCACAAATTGGAACATGG + Intergenic
1009975202 6:70664632-70664654 CAGTGGCAGTATGGAGAACATGG - Intergenic
1010012199 6:71061201-71061223 CAGAGGCACCAAGGGGAGCAGGG - Intergenic
1010722689 6:79301728-79301750 CAGTGGCAAAAATGGGAAAAAGG - Intergenic
1011174715 6:84547319-84547341 CAGTGGCACAAATGGAAACTAGG - Intergenic
1011750353 6:90449099-90449121 CAGAGGCACCAATGGGCAGATGG - Intergenic
1012877869 6:104750813-104750835 CAGGGGCAAAAATGGAAACAGGG - Intronic
1015469482 6:133587535-133587557 CAGTTGCACTCCTGGGAAAATGG - Intergenic
1018117528 6:160601886-160601908 CAGTGGCACTCATGGCATAAAGG + Intronic
1018919457 6:168161270-168161292 CAGTGGCAGTAACGGCAGCATGG + Intergenic
1019235460 6:170608828-170608850 CAGTCCCACTCATGGGGACATGG - Intergenic
1019240704 6:170660393-170660415 CAGTGCCTCTCATGGGGACAGGG - Intergenic
1022341831 7:29475892-29475914 CAGTGGTACTGATGGGTACAGGG + Intronic
1025818010 7:64936472-64936494 CAGAGGGATTACTGGGAACATGG + Intergenic
1026367040 7:69659109-69659131 CAGTGCCACAAATGTAAACAGGG + Intronic
1028659177 7:93248818-93248840 CAGTGGGACTAAAAAGAACACGG + Intronic
1030812971 7:113998438-113998460 CACTGTCATTAATGGGAATAAGG - Intronic
1031023147 7:116650168-116650190 GAGTTGCAATAATGGGTACATGG - Intergenic
1035515301 8:227805-227827 CAGTCCCACTCATGGGGACATGG - Intergenic
1042356972 8:67839175-67839197 CAGTCTCACTAATGGTATCAAGG + Intergenic
1043494154 8:80781730-80781752 GGGTGTCACTCATGGGAACATGG + Intronic
1044592681 8:93929502-93929524 CAGAGGCAGTAATGGGGTCAGGG + Intergenic
1046906889 8:119583069-119583091 CAGTGGCACTTCAGGGGACAGGG - Intronic
1049125961 8:140788091-140788113 CAGTGTCACTACTGGAAACTAGG + Intronic
1050519160 9:6479115-6479137 CAGTGGGAGAAATGGGATCAAGG - Intronic
1050742617 9:8839766-8839788 CAGTGGGAGAAATGGGAAGAAGG + Intronic
1053270498 9:36746227-36746249 CACTGACTCTAAGGGGAACATGG - Intergenic
1055388727 9:75795148-75795170 CAGTGGTACTCATGGAAACTAGG - Intergenic
1060664160 9:125423069-125423091 CAGTGTCACTCTTGGGCACACGG + Intergenic
1186937517 X:14466800-14466822 TACTGGGACTAATGGGAAGAGGG - Intergenic
1189471143 X:41315218-41315240 CAGAGGCAATAATGGCAACAGGG + Intergenic
1196572041 X:117277604-117277626 CAGAGACACTCATGGGAAAAAGG + Intergenic
1200673887 Y:6127214-6127236 CAGTAGCAGCAGTGGGAACATGG + Intergenic