ID: 1168185102

View in Genome Browser
Species Human (GRCh38)
Location 19:54695538-54695560
Sequence GTGGATTAAGGCACAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168185095_1168185102 25 Left 1168185095 19:54695490-54695512 CCGAAATCAGAGCTCAAACCTAA 0: 1
1: 0
2: 4
3: 20
4: 224
Right 1168185102 19:54695538-54695560 GTGGATTAAGGCACAGAGGAAGG 0: 1
1: 0
2: 0
3: 27
4: 270
1168185096_1168185102 7 Left 1168185096 19:54695508-54695530 CCTAACGTAATTGCTCCAAAAAC 0: 1
1: 0
2: 1
3: 46
4: 839
Right 1168185102 19:54695538-54695560 GTGGATTAAGGCACAGAGGAAGG 0: 1
1: 0
2: 0
3: 27
4: 270
1168185098_1168185102 -8 Left 1168185098 19:54695523-54695545 CCAAAAACCTTAAACGTGGATTA No data
Right 1168185102 19:54695538-54695560 GTGGATTAAGGCACAGAGGAAGG 0: 1
1: 0
2: 0
3: 27
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168185102 Original CRISPR GTGGATTAAGGCACAGAGGA AGG Intronic
902448435 1:16482408-16482430 GGTGATGAGGGCACAGAGGAAGG + Intergenic
904030764 1:27532220-27532242 GTTGATTATGGCACAGTGAAGGG - Intergenic
904094160 1:27964836-27964858 GTGGAGGAAGGCAAAGGGGAAGG - Intronic
904409924 1:30319240-30319262 GTGAATAAATGCACTGAGGAAGG + Intergenic
905008351 1:34729433-34729455 GTAGACAAAGGCACACAGGAGGG + Intronic
906946427 1:50298350-50298372 TTGGCTTAAGTCACAGAGGTTGG - Intergenic
907861481 1:58357883-58357905 GTGGAGGAAGGCAGGGAGGATGG - Intronic
909072686 1:71015573-71015595 GTGGAAAAAGACACAGAAGATGG - Intronic
909343085 1:74553536-74553558 GTAGAGTAAGGCCTAGAGGAAGG - Intergenic
910049966 1:82961756-82961778 CTGGATTCAGGTACAGGGGAAGG + Intergenic
911680123 1:100705504-100705526 GTTGATTAAGGATCAGAGGAAGG + Intergenic
911848791 1:102787897-102787919 CAGGATTAAGGCAGAGAGAAAGG - Intergenic
911989098 1:104669505-104669527 GTGGATTCAGGCACTGAAGGAGG - Intergenic
916074210 1:161190991-161191013 GCGCATTAGGGCAGAGAGGAGGG + Exonic
916635581 1:166664540-166664562 GTGAACTAGGGTACAGAGGAAGG + Intergenic
917214429 1:172663541-172663563 ATGAACAAAGGCACAGAGGAAGG + Intronic
917596904 1:176538472-176538494 GTGGATCAAGGCACAGACCTTGG - Intronic
917680202 1:177358128-177358150 GGGAATGAAGGCAGAGAGGATGG + Intergenic
919905523 1:202075794-202075816 GTAGACCAAGGCACATAGGAGGG + Intergenic
920119225 1:203643205-203643227 GTGAAATAAGGCAGAGTGGAGGG + Intronic
921412571 1:214851397-214851419 GAGGATACAGGCACAGAGCATGG - Intergenic
922198943 1:223384905-223384927 ATGGATGAAGACCCAGAGGAAGG + Intergenic
923404982 1:233650940-233650962 GTGGATGGAGGCTCAGAGGTTGG + Intronic
923520286 1:234730208-234730230 GTGGCTTAAGGAACAGGGGCTGG - Intergenic
924395242 1:243611836-243611858 GTTGTTTCAGGCAGAGAGGATGG - Intronic
1063313345 10:4977784-4977806 GTGGATGGTGACACAGAGGATGG + Exonic
1063314608 10:4989932-4989954 GTGGATGGTGACACAGAGGATGG - Exonic
1064245651 10:13665897-13665919 GTGGACTCAGACACAGATGAAGG - Intronic
1065075472 10:22074477-22074499 GAGGGTTGAGGGACAGAGGAAGG - Intergenic
1066443867 10:35464179-35464201 CTGGGCTAAGGCACAGAGGAGGG - Intronic
1067808242 10:49407946-49407968 ATGGATGAAGGGACAGATGATGG + Intergenic
1069662680 10:70133884-70133906 GTAGATTTAGGTAAAGAGGAAGG + Intergenic
1069793293 10:71036958-71036980 CTGGAGTAAAGCAGAGAGGATGG + Intergenic
1070675747 10:78410236-78410258 TGGGACCAAGGCACAGAGGAGGG - Intergenic
1071832721 10:89387997-89388019 GTGGATAAAATCACATAGGAAGG + Intronic
1073028108 10:100503154-100503176 GTGGGTAAAGGCACAGAAGCAGG - Intronic
1073219070 10:101854551-101854573 GTGTTTTAAGGCAAAGAAGAGGG - Intronic
1074394857 10:113089298-113089320 GTGGGTTAGGGCAGAAAGGAAGG + Intronic
1074533651 10:114313453-114313475 GGTGATTAAGGCTCAAAGGATGG - Intronic
1075388647 10:122076248-122076270 GTGGCTTTATGCAAAGAGGAAGG - Intronic
1080915971 11:36659926-36659948 AGGGATGAAGGCCCAGAGGAAGG + Intergenic
1081059511 11:38455833-38455855 GTGGACTAAGATACAGAGGATGG + Intergenic
1082737731 11:56874972-56874994 GTGGCTCAAGCCTCAGAGGAAGG + Intergenic
1082774672 11:57236066-57236088 GTCGAAAAAGGCATAGAGGAAGG + Exonic
1085038272 11:73312437-73312459 GGAGATTAAGTCACAGAGAAAGG - Intronic
1085303702 11:75473417-75473439 GTGGACTGAGGTGCAGAGGAAGG - Intronic
1085535818 11:77216749-77216771 GTTGATAAAGGCACACAGAAGGG - Exonic
1090466291 11:126937570-126937592 CTTGTTTCAGGCACAGAGGAGGG - Intronic
1090538635 11:127675672-127675694 GTGGATATAGGCACAGAGACTGG - Intergenic
1091226477 11:133959378-133959400 AGGGATGAAGGCAGAGAGGAAGG + Intergenic
1091442832 12:524973-524995 GTGGGTTAATGTACAGAGGAGGG + Intronic
1091718366 12:2795411-2795433 GTCGTTTAAGGCACCGAGGCCGG + Intronic
1092071968 12:5638667-5638689 GTGGCTTAAGGCACAGAATGTGG - Intronic
1093920179 12:24850756-24850778 GAGGATTTATGGACAGAGGAAGG - Intronic
1095890558 12:47231797-47231819 GTGTATTAGGGCACAGATTACGG + Intronic
1099326760 12:81225978-81226000 GTGGCTTAATGCACAAAGGCAGG - Intronic
1100138417 12:91585311-91585333 GAGGACTAAAGCAGAGAGGAAGG + Intergenic
1100694378 12:97075569-97075591 GTGCATTAAGGCAAAGAACAAGG - Intergenic
1101081464 12:101189679-101189701 TTGGATGAACGCACAGAGGTAGG - Intronic
1102196843 12:111032611-111032633 GGGGAATAAGCCAGAGAGGAAGG + Intergenic
1104273191 12:127301163-127301185 GTAGATAAAAGCAGAGAGGAGGG - Intergenic
1104843677 12:131836184-131836206 GGGGGTAAAGGCACAGAGGGGGG + Intronic
1104984235 12:132587619-132587641 CTGCATTGAGGCACAGAGAAGGG + Intergenic
1106170281 13:27282832-27282854 GAAGATTAAGGCAGAGATGAAGG + Intergenic
1106479508 13:30126505-30126527 GTGAATTCAAGCACAGAGGGTGG - Intergenic
1108027615 13:46194988-46195010 ATGGATTAAGGCACCCAGCATGG - Intronic
1109208061 13:59503877-59503899 GTGGCTGCAGTCACAGAGGATGG - Intergenic
1113955251 13:114096938-114096960 AAGGATTGAGACACAGAGGAGGG - Intronic
1118500882 14:66361597-66361619 GTGGATTAGGAGAGAGAGGAAGG - Intergenic
1118780804 14:69006376-69006398 GTGGAATGAGACACAGAGGATGG - Intergenic
1119925726 14:78491422-78491444 GAGGAGTGAGGCAGAGAGGAAGG + Intronic
1121108456 14:91296063-91296085 GTGGCTTAAGCCGCAGAGGTGGG - Intronic
1121504760 14:94468366-94468388 GTGGATGAAGGGAGGGAGGAAGG + Intronic
1121888796 14:97570268-97570290 GTGGAATCTCGCACAGAGGAGGG - Intergenic
1122289520 14:100672701-100672723 GGGGAACAAGGCAGAGAGGAAGG - Intergenic
1124204148 15:27703090-27703112 GAGGCTCAAGGCACAGTGGATGG - Intergenic
1124640742 15:31394589-31394611 GTGGATATGGGCAGAGAGGATGG + Intronic
1127635195 15:60862486-60862508 GTGGATCAAGGCACTGATGGAGG + Intronic
1128258815 15:66217598-66217620 GGGGATTAAGGCACAGGAAAGGG + Intronic
1128770286 15:70276899-70276921 GGGGATTAAGGAAGAGGGGATGG + Intergenic
1128824783 15:70703761-70703783 GAAGATTAAGCCACAGAGGCTGG - Intronic
1129644353 15:77417124-77417146 ATGGATGGAAGCACAGAGGAGGG - Intronic
1130053225 15:80501570-80501592 CTGGAATAATGCACAGAGCAAGG - Intronic
1133812817 16:9174313-9174335 ATGGAGGAAGGCAGAGAGGAGGG + Intergenic
1134848573 16:17461569-17461591 ATGGATGAATGGACAGAGGATGG + Intronic
1135082182 16:19445761-19445783 CTGGAAGAAGGCAGAGAGGAGGG + Intronic
1135381766 16:22001521-22001543 GGGGGAGAAGGCACAGAGGAGGG + Intergenic
1135896103 16:26404582-26404604 GTTGATAAAGGCAGAGTGGATGG - Intergenic
1139312814 16:66041596-66041618 GTGGAAGATGGCACAGAGGGGGG + Intergenic
1140444144 16:75011024-75011046 CTGGATTCAGGAACAGAGGTAGG + Intronic
1140684679 16:77422123-77422145 GTGAATTAATGCACAGAAGCAGG - Intronic
1142121556 16:88388960-88388982 CTGGTGTAAGGCACAGAGGATGG - Intergenic
1142291202 16:89194352-89194374 GTGCAGACAGGCACAGAGGAGGG - Intronic
1147160803 17:38568474-38568496 GTGGGAAAAGGCACAGAGGATGG + Intronic
1148093942 17:45039668-45039690 GGGGACTGAGGCTCAGAGGAGGG - Intronic
1148736668 17:49869129-49869151 GAGGGTAAAGGCACAGAAGAGGG - Intergenic
1150272993 17:63878693-63878715 GGGGGTTCAGGCACGGAGGAAGG + Intronic
1150278652 17:63915992-63916014 GGGGGTTCAGGCACGGAGGAAGG + Intronic
1150279753 17:63922611-63922633 GGGGGTTCAGGCACGGAGGAAGG + Intergenic
1153179630 18:2418437-2418459 GGGTATTAAGGCTGAGAGGAAGG + Intergenic
1153354895 18:4123732-4123754 GTAGATTAAGACCCTGAGGAAGG - Intronic
1157332266 18:46712546-46712568 GGGGCTGCAGGCACAGAGGAGGG - Intronic
1158020072 18:52831472-52831494 GAGGATGAAGGCTCAGAGAAGGG + Intronic
1160879547 19:1313236-1313258 CTGGACAAAGGCACAGTGGAGGG - Intergenic
1162482107 19:10933726-10933748 GAGGATTAAGTCACAGAGCTGGG - Intergenic
1162520680 19:11177826-11177848 GTGGGTAAAGGCTCAGAGGTGGG - Intronic
1164389569 19:27806042-27806064 GTGGATGAAGCCGCAGAGCAGGG + Intergenic
1164432038 19:28197223-28197245 GGTGATTAAGGCAGAGAGGATGG - Intergenic
1164686122 19:30167814-30167836 GTGGATGCAGGCACAGATGAAGG + Intergenic
1164716397 19:30393730-30393752 GAGGCTAGAGGCACAGAGGAAGG + Intronic
1165593553 19:36991645-36991667 GTAGATTAAGGGTCAGAAGAAGG - Intronic
1166825565 19:45607039-45607061 GTGGAGAAAGCCACAAAGGATGG + Intronic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
1167151957 19:47715364-47715386 GGGGATTTAGGCAGAGAGGACGG - Intronic
1167405122 19:49301711-49301733 GTGGTTTCAGGGACAGAGGAAGG - Intronic
1168185102 19:54695538-54695560 GTGGATTAAGGCACAGAGGAAGG + Intronic
1168309802 19:55454745-55454767 GAGGGTCAGGGCACAGAGGAGGG - Intronic
1168414309 19:56159032-56159054 GTGGATGAATGTACAGATGATGG - Intronic
1168414334 19:56159151-56159173 GTGGATGAATGTACAGATGATGG - Intronic
925785470 2:7428298-7428320 GTGGAAGAATGCACAGATGAAGG - Intergenic
925803455 2:7625484-7625506 GTGGATTGATTCACTGAGGAGGG - Intergenic
926076830 2:9949703-9949725 TTGGACCAGGGCACAGAGGAGGG + Intergenic
926832244 2:16976316-16976338 GGGGGATAAGGCACAGAGGCTGG + Intergenic
926844957 2:17126183-17126205 GTGGAGCAAGGCACAGTAGATGG - Intergenic
926925428 2:17982551-17982573 ATGTATAAAGGCACAGATGAAGG - Intronic
927091685 2:19717290-19717312 GAGGATGAAGGCAGAGAGCAGGG + Intergenic
927478576 2:23432955-23432977 GTGGGGGAAGGCACAGAGAAAGG + Intronic
929989918 2:46778237-46778259 TTGGATGAGGGCACAGAGGCAGG + Intergenic
930366205 2:50442815-50442837 TTGGAAGAAGTCACAGAGGAAGG + Intronic
931790253 2:65658349-65658371 GGGGATTAAAGGGCAGAGGAAGG + Intergenic
932083840 2:68739740-68739762 GGGGATTCTGTCACAGAGGATGG + Intronic
932865659 2:75339083-75339105 GTAGAAGAAGGCACAGAGAATGG - Intergenic
933248246 2:79999648-79999670 ATGGATGAATGGACAGAGGAAGG - Intronic
934150907 2:89146774-89146796 CTGAATTAAGGCAGAGAGAAAGG - Intergenic
934216367 2:90035251-90035273 CTGAATTAAGGCAGAGAGAAAGG + Intergenic
935095767 2:99942862-99942884 TGGGATTAAGGCACAGATAAAGG - Intronic
936667272 2:114610852-114610874 GTGGATTAGGCAACAGAGGGTGG - Intronic
936966278 2:118130297-118130319 GTGGAATAAGGCAGACAAGATGG + Intergenic
936987433 2:118324639-118324661 GTGGGTTGAGGGACAGAGAATGG + Intergenic
937757924 2:125563348-125563370 TTGGAGAAAGGCCCAGAGGAAGG - Intergenic
939475179 2:142677629-142677651 CTGGATGAAGACACACAGGAGGG - Intergenic
940645501 2:156388626-156388648 CTGGAAGTAGGCACAGAGGAAGG - Intergenic
942179709 2:173368700-173368722 CTTGATTAATGCAAAGAGGAGGG - Exonic
944665641 2:201956718-201956740 GTGGAGAAGGGCACAGAAGAGGG - Intergenic
944927739 2:204482346-204482368 GTAGACTAAGGGAGAGAGGATGG - Intergenic
945946571 2:216001188-216001210 GTGGATTAAGGACGAGAGGCTGG - Intronic
945972339 2:216243091-216243113 GTGGAGGAGGGCTCAGAGGAAGG - Intergenic
945984664 2:216343992-216344014 GAGGAAGAAGCCACAGAGGATGG + Intronic
947367532 2:229412638-229412660 GTGGATGAAAGCAAAGAGGAGGG + Intronic
1170131274 20:13022764-13022786 GTGGATTGTGGCAGAGGGGAGGG - Intronic
1170594228 20:17793275-17793297 ATGGATTAAGACACAGATGTAGG - Intergenic
1170948458 20:20912579-20912601 GTGGATGAAGGTTCCGAGGATGG + Intergenic
1171086061 20:22239358-22239380 GTGGATTGAAGTGCAGAGGAGGG - Intergenic
1172709724 20:36912227-36912249 GTGGATAAAGGGGCAGATGAAGG - Intronic
1172780401 20:37433335-37433357 GTGGATGTCAGCACAGAGGAAGG + Intergenic
1173598273 20:44274271-44274293 GTGGATGATGCCACAGAGAAGGG - Intronic
1174185333 20:48702400-48702422 GTGGATTGAGGGTCAGCGGAGGG - Intronic
1174359202 20:50017316-50017338 TTGGACTGAGGCACAGAGAAAGG - Intergenic
1175187050 20:57185721-57185743 GTGCATTAAGTGACAGAGGCAGG - Intronic
1175333072 20:58177856-58177878 GTGGATTAGGGCCCAGACTAGGG - Intergenic
1175726556 20:61322515-61322537 GGGGATTCAGGCACCAAGGAAGG - Intronic
1176130045 20:63492938-63492960 GTGGATGGATGGACAGAGGATGG + Intronic
1178214565 21:30579592-30579614 TTGGATTAATGCACAGATGAAGG + Intergenic
1179165184 21:38929956-38929978 ATGGACTAAGGCACTGATGAAGG + Intergenic
1180173164 21:46071366-46071388 GTGGAGGAACCCACAGAGGAGGG + Intergenic
1181867186 22:25868115-25868137 GTGTATGAAGGCAGAGTGGATGG + Intronic
1182840895 22:33389111-33389133 ATGGACAAAGGCACAGAGGCAGG + Intronic
1183504084 22:38199437-38199459 GTGGACCAAGGCACAGAGGCAGG + Intronic
1184835700 22:47019785-47019807 GAGGGTTAAGGCAGAGGGGAAGG - Intronic
950464364 3:13144565-13144587 GTCTCTTAAGGCCCAGAGGAAGG - Intergenic
950570709 3:13798381-13798403 GTGGATTAAGGCATCGAGGCAGG - Intergenic
952849142 3:37713471-37713493 ATGGATTGAGCCACAGAGGGAGG + Intronic
953537746 3:43788874-43788896 CTGGAGTAAGATACAGAGGAGGG - Intergenic
955458900 3:59157823-59157845 ATGGAGTAAGACACAGAGTATGG - Intergenic
956225255 3:66950313-66950335 ATTGAGTAAGGCACAGATGAGGG + Intergenic
957893478 3:86389305-86389327 GAGGATTAGGGGAGAGAGGAAGG - Intergenic
958108415 3:89107330-89107352 GTGAATTAAGCAACAGAGCATGG + Intergenic
958546478 3:95558778-95558800 GTGGCTAAAAGCACAGGGGAAGG + Intergenic
959495290 3:107043176-107043198 GAGGATGGAGGCAGAGAGGAAGG + Intergenic
961642066 3:128370955-128370977 GTGTGCTAGGGCACAGAGGATGG + Intronic
963279501 3:143368519-143368541 GTGGATTAAGTGAGAGAGGGAGG + Intronic
964174129 3:153805014-153805036 GTGGATGAAGGATTAGAGGAAGG - Intergenic
965816433 3:172641505-172641527 GTGGATTATGGCACTGGGGAAGG - Intronic
967686123 3:192418764-192418786 ATGGTGTAAGGCAAAGAGGAAGG - Intronic
967866975 3:194198252-194198274 GTGCATTTAGGCAGAGTGGAGGG + Intergenic
969513544 4:7633361-7633383 GGGGCTTCAGGCAGAGAGGACGG - Intronic
971642505 4:29153849-29153871 ATGGAGGAAGGCAAAGAGGAAGG + Intergenic
971773429 4:30928622-30928644 GTGGTGTGAGGTACAGAGGAGGG + Intronic
971896786 4:32606445-32606467 ATGGAAGAAGGCAAAGAGGAAGG + Intergenic
975211163 4:71701507-71701529 GTGGATTATGGCACCAAAGAAGG + Intergenic
975221640 4:71819164-71819186 ATGAATGAAGGGACAGAGGAAGG + Intergenic
977257803 4:94758871-94758893 GAGGATGAAGGGACAGAGGAGGG - Intronic
977606391 4:98988910-98988932 CTGAATTAAGGAACAGAGAAGGG + Intergenic
979838192 4:125401015-125401037 GTGTAGAAAGGCAGAGAGGATGG + Intronic
980556665 4:134415480-134415502 GTGGATCAAAGAACAGAGCACGG - Intergenic
981966224 4:150607291-150607313 CTGGATTAAGGCAGTGAGGATGG + Intronic
982321170 4:154078721-154078743 GTGGTTTAAGGCATGGAGAAAGG + Intergenic
983625434 4:169797351-169797373 CGGCAATAAGGCACAGAGGAGGG - Intergenic
985614397 5:910841-910863 GAGGAACAAGGCACAGAGGTTGG - Intronic
986199588 5:5569328-5569350 TGGGATTAAGGCAGATAGGAAGG - Intergenic
987508491 5:18803619-18803641 ATGGATGAAGACAAAGAGGAAGG + Intergenic
989501278 5:42170993-42171015 CAGAGTTAAGGCACAGAGGAAGG + Intergenic
989661213 5:43799790-43799812 GTCTCTTAAGGCACAGAGTATGG - Intergenic
990798044 5:59566281-59566303 GTGGAGGCAGGCACAGAGGTGGG - Intronic
992184002 5:74225936-74225958 GGAGAAGAAGGCACAGAGGAAGG - Intergenic
994063417 5:95507064-95507086 GTGGATTCAGCTAAAGAGGAAGG - Intronic
994975271 5:106796569-106796591 GGGGATCAAGGCATAGAGGAAGG + Intergenic
995053340 5:107731339-107731361 GTTGATTAAGGCACAGAAGCAGG + Intergenic
997792407 5:136772573-136772595 GTGGAGCAGGGCACAGAGGTGGG + Intergenic
998400442 5:141846040-141846062 GTGGATTCGGGCCCTGAGGACGG - Intergenic
998951542 5:147397665-147397687 GCGCATTAAAGCACGGAGGAAGG - Exonic
999191039 5:149747767-149747789 GTGGATGCAGGCACAGTGGGAGG - Intronic
999267562 5:150276782-150276804 GTGGATGGAGGGATAGAGGAAGG + Intronic
1000176703 5:158763160-158763182 GGGGACTGAGGCACAAAGGAGGG + Intronic
1000191215 5:158912735-158912757 GTGGAATTAGGCATAGTGGAGGG - Intronic
1002517979 5:179773692-179773714 GTTCAGAAAGGCACAGAGGAAGG - Intronic
1004827728 6:19441867-19441889 ATGGATAAAGGAAGAGAGGAAGG + Intergenic
1005637453 6:27765549-27765571 ATGGATTGAGGCAGAGAGAAAGG + Intergenic
1006227860 6:32555583-32555605 GTGGATAAAGGGACAGAGTAGGG + Intronic
1006336352 6:33422830-33422852 GGGGAGGAGGGCACAGAGGAGGG + Intronic
1006598274 6:35209271-35209293 GTGGATGTGGGCAGAGAGGAGGG + Intergenic
1007830815 6:44637005-44637027 GTGGCTGCAGGCACAGAGGATGG - Intergenic
1007890775 6:45288846-45288868 ATGGATCAATGGACAGAGGATGG - Intronic
1011202850 6:84856501-84856523 GTGGTTTAAGAACCAGAGGAGGG - Intergenic
1011388968 6:86830004-86830026 GTAGATCATGGCAAAGAGGATGG - Intergenic
1011712716 6:90070866-90070888 GTGGTTGAAGGAACAGAGAAAGG - Intronic
1011826431 6:91311040-91311062 GAGGATTGATGCACAGTGGAGGG + Intergenic
1013617496 6:111858467-111858489 GTACATTAAGCCACGGAGGAGGG - Intronic
1014812305 6:125901184-125901206 GTATATTATGGCACAGAGAATGG - Intronic
1015401308 6:132791647-132791669 GTGGGTGAGGGCAGAGAGGATGG + Intronic
1015614516 6:135061101-135061123 GTGCTTTAAGGCACACAGGAGGG - Intronic
1015878234 6:137845585-137845607 GTGGAGTGGAGCACAGAGGAAGG + Intergenic
1016528603 6:145033317-145033339 GTGGAATAAGAAACAAAGGATGG - Intergenic
1017159146 6:151349175-151349197 GTGGAGGAATGCAAAGAGGAAGG + Exonic
1018689548 6:166333664-166333686 GTGGAGTCAGGCACAGGGCAGGG + Intronic
1018992774 6:168686674-168686696 GAGGATGCAGGCACAGAGCAGGG + Intergenic
1019519955 7:1456098-1456120 GGTGATGAAGGCACAGAGGCAGG + Intronic
1019614142 7:1951281-1951303 GTGGATGAAGGGCCTGAGGAAGG + Intronic
1020040022 7:4994956-4994978 GTGGAGGAAGGCAAAGGGGAAGG - Intronic
1020099197 7:5385071-5385093 GGAGGTGAAGGCACAGAGGATGG + Intronic
1022592730 7:31681227-31681249 GTGGATTGAGGCAGGGAAGATGG - Intergenic
1023057973 7:36304851-36304873 GTGAAATAAGGGAGAGAGGAAGG + Intergenic
1023123817 7:36935519-36935541 GTGCATTAAGGCACAAAAGGAGG + Intronic
1025025815 7:55515272-55515294 GTCCATTCAGGCACCGAGGAAGG + Intronic
1025607170 7:63047731-63047753 GCTGAGGAAGGCACAGAGGAGGG - Intergenic
1026566981 7:71497213-71497235 GTGGATTAGTGCACAGAAGAAGG - Intronic
1027492621 7:78848436-78848458 GTGGAGAAAGGCTCAAAGGATGG - Intronic
1030616348 7:111742120-111742142 GTGAATTAAGGCACAGATTCTGG - Exonic
1032609659 7:133398551-133398573 GTGGATTAGAGCACACAGTAGGG + Intronic
1033296210 7:140138583-140138605 GGGGTTTCAGGCAGAGAGGATGG + Intronic
1033500830 7:141947144-141947166 GGAGATTTAGACACAGAGGAAGG - Intronic
1033819202 7:145113241-145113263 GTGGCTAAAGGCAAAGTGGATGG - Intergenic
1034543003 7:151771087-151771109 CTGAAGTAAGGAACAGAGGAGGG - Intronic
1035295482 7:157864847-157864869 GCAGGTTCAGGCACAGAGGAGGG - Intronic
1037994402 8:23341997-23342019 GTGGAGTAAAGGACAGAGGCTGG + Intronic
1038466925 8:27772752-27772774 GTGGGTTAAGGGAAAGAGGCTGG + Intronic
1042056498 8:64769767-64769789 GTGGGTTAAGGCACGGAGACAGG - Intronic
1043441201 8:80278498-80278520 GATGCTTAAGGGACAGAGGAAGG - Intergenic
1043787043 8:84416376-84416398 GTGGATAAAGGCCCAGGGGCAGG + Intronic
1044963425 8:97553477-97553499 GTCCATTATGACACAGAGGAAGG + Intergenic
1045071903 8:98515088-98515110 GTGGATTAAGGCAAAGATAGTGG - Intronic
1046026482 8:108730254-108730276 GTGGATTTAGACACATAGGCTGG - Intronic
1046805943 8:118479155-118479177 GTGAATTAAGGTACAGTGGTAGG - Intronic
1047253882 8:123201249-123201271 GGGGATTTAGGCACAGAGAGGGG + Intronic
1048054096 8:130846949-130846971 GGGAATTAAGGAACAAAGGAAGG - Intronic
1049389120 8:142359071-142359093 CTGGGTGAAGGCACAGAGGTGGG - Intronic
1050099913 9:2107980-2108002 GTGGTGTAAGGCACAGGGAAAGG + Intronic
1050711865 9:8474473-8474495 CTGGATTCTGGCACAGAGAATGG - Intronic
1053284455 9:36841354-36841376 GTGGGGAAAGGCACAGAGGCAGG - Intronic
1055527400 9:77148793-77148815 GTGGATGAAGGAACAGAGAAAGG + Intergenic
1055641114 9:78319732-78319754 GTGGAATTAGGCAGAGAAGAGGG + Intronic
1055734260 9:79310829-79310851 GTTAATTAAAGCACAGAGGTTGG + Intergenic
1056102762 9:83315603-83315625 GTGGTGGAAGGCAAAGAGGAAGG - Intronic
1056404280 9:86259234-86259256 GAGGATGAAGGCACTGAGGTTGG + Intronic
1056836050 9:89956412-89956434 GTGGATGGAGGTAGAGAGGAAGG - Intergenic
1057284741 9:93742932-93742954 ATGGATCAAGGCATACAGGAAGG + Intergenic
1060114825 9:120931619-120931641 CTGGCTTAGGGCAGAGAGGAAGG - Intergenic
1060817769 9:126644381-126644403 GTGGAGTCAGGCTCAGAAGAGGG + Intronic
1185839490 X:3375414-3375436 GTGAATCAGGGCAAAGAGGAAGG + Intergenic
1187205594 X:17178085-17178107 GTAGATGTAGCCACAGAGGAAGG + Intergenic
1188175958 X:26989607-26989629 GTGGATAAAGGCATAGATGGAGG - Intergenic
1188897898 X:35693275-35693297 GTGGAATAGGGCCCAGATGAAGG + Intergenic
1190460967 X:50674901-50674923 GTGGTTAAGTGCACAGAGGACGG + Intronic
1190968968 X:55330596-55330618 GAGAATTAGGGCACAGAGCAGGG - Intergenic
1191869150 X:65730849-65730871 GTGGATGAAGGTACAAAGGAAGG + Intronic
1192461417 X:71320467-71320489 CTGGACAAAGGCACAGAGGTGGG - Intergenic
1193689408 X:84622455-84622477 GTGGAGTAAAGCACTGAGGCTGG + Intergenic
1193853842 X:86573738-86573760 GTGGAATTAGGCACATAGAATGG - Intronic
1195682605 X:107560125-107560147 CTAGATCAAGGGACAGAGGAAGG - Intronic
1195757121 X:108210358-108210380 GGGGATGAAGGCACACAGGAAGG - Intronic
1196017700 X:110956995-110957017 GTGGATTAATGTATAGAGAAAGG - Intronic
1197013306 X:121593625-121593647 TTGGATGAAGGAACAGAGGCAGG - Intergenic
1198323687 X:135545073-135545095 ATGGAGTAAGGGGCAGAGGAAGG - Intronic
1199365432 X:146975313-146975335 ATGTATGAAGGAACAGAGGAAGG + Intergenic
1199476283 X:148249107-148249129 GTGGATTAAGGTAGTGAGCAGGG - Intergenic
1200166623 X:154040008-154040030 GTGGAGGAAGTCACTGAGGAGGG + Intronic
1200249079 X:154542594-154542616 GAGGAGGAAGGGACAGAGGAAGG + Intronic
1201696200 Y:16829138-16829160 AGGGATTGAGGGACAGAGGAAGG + Intergenic