ID: 1168186892

View in Genome Browser
Species Human (GRCh38)
Location 19:54705744-54705766
Sequence GACCCTATGTTTGTTCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168186892_1168186895 5 Left 1168186892 19:54705744-54705766 CCAGCAGGAACAAACATAGGGTC No data
Right 1168186895 19:54705772-54705794 TGATGGAACTCACTTCCTGGAGG No data
1168186892_1168186894 2 Left 1168186892 19:54705744-54705766 CCAGCAGGAACAAACATAGGGTC No data
Right 1168186894 19:54705769-54705791 ACATGATGGAACTCACTTCCTGG No data
1168186892_1168186897 24 Left 1168186892 19:54705744-54705766 CCAGCAGGAACAAACATAGGGTC No data
Right 1168186897 19:54705791-54705813 GAGGCCAAGAAAGACACTTGCGG No data
1168186892_1168186898 25 Left 1168186892 19:54705744-54705766 CCAGCAGGAACAAACATAGGGTC No data
Right 1168186898 19:54705792-54705814 AGGCCAAGAAAGACACTTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168186892 Original CRISPR GACCCTATGTTTGTTCCTGC TGG (reversed) Intergenic
No off target data available for this crispr