ID: 1168187617

View in Genome Browser
Species Human (GRCh38)
Location 19:54709861-54709883
Sequence GGGTCCCTGACTGAACCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168187617_1168187624 2 Left 1168187617 19:54709861-54709883 CCAGCAGGTTCAGTCAGGGACCC No data
Right 1168187624 19:54709886-54709908 GCTCCGCACAGGCCCTGCTGGGG No data
1168187617_1168187625 3 Left 1168187617 19:54709861-54709883 CCAGCAGGTTCAGTCAGGGACCC No data
Right 1168187625 19:54709887-54709909 CTCCGCACAGGCCCTGCTGGGGG No data
1168187617_1168187622 0 Left 1168187617 19:54709861-54709883 CCAGCAGGTTCAGTCAGGGACCC No data
Right 1168187622 19:54709884-54709906 AGGCTCCGCACAGGCCCTGCTGG No data
1168187617_1168187633 25 Left 1168187617 19:54709861-54709883 CCAGCAGGTTCAGTCAGGGACCC No data
Right 1168187633 19:54709909-54709931 GAGCCCAGGTGGTGATGGCCGGG 0: 5
1: 0
2: 4
3: 26
4: 342
1168187617_1168187623 1 Left 1168187617 19:54709861-54709883 CCAGCAGGTTCAGTCAGGGACCC No data
Right 1168187623 19:54709885-54709907 GGCTCCGCACAGGCCCTGCTGGG No data
1168187617_1168187627 11 Left 1168187617 19:54709861-54709883 CCAGCAGGTTCAGTCAGGGACCC No data
Right 1168187627 19:54709895-54709917 AGGCCCTGCTGGGGGAGCCCAGG No data
1168187617_1168187629 14 Left 1168187617 19:54709861-54709883 CCAGCAGGTTCAGTCAGGGACCC No data
Right 1168187629 19:54709898-54709920 CCCTGCTGGGGGAGCCCAGGTGG 0: 2
1: 2
2: 5
3: 62
4: 507
1168187617_1168187619 -9 Left 1168187617 19:54709861-54709883 CCAGCAGGTTCAGTCAGGGACCC No data
Right 1168187619 19:54709875-54709897 CAGGGACCCAGGCTCCGCACAGG No data
1168187617_1168187632 24 Left 1168187617 19:54709861-54709883 CCAGCAGGTTCAGTCAGGGACCC No data
Right 1168187632 19:54709908-54709930 GGAGCCCAGGTGGTGATGGCCGG 0: 7
1: 0
2: 4
3: 41
4: 434
1168187617_1168187631 20 Left 1168187617 19:54709861-54709883 CCAGCAGGTTCAGTCAGGGACCC No data
Right 1168187631 19:54709904-54709926 TGGGGGAGCCCAGGTGGTGATGG 0: 2
1: 4
2: 5
3: 49
4: 672

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168187617 Original CRISPR GGGTCCCTGACTGAACCTGC TGG (reversed) Intergenic
No off target data available for this crispr