ID: 1168191216

View in Genome Browser
Species Human (GRCh38)
Location 19:54739987-54740009
Sequence CAGGGTAGACATGAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 3, 2: 0, 3: 21, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168191216_1168191222 21 Left 1168191216 19:54739987-54740009 CCCTCCACCTCATGTCTACCCTG 0: 1
1: 3
2: 0
3: 21
4: 256
Right 1168191222 19:54740031-54740053 TTACAGTATTAAAATCTAGTAGG 0: 4
1: 0
2: 4
3: 38
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168191216 Original CRISPR CAGGGTAGACATGAGGTGGA GGG (reversed) Intronic
900348633 1:2224381-2224403 CAGTGTGGAGATGAGTTGGATGG - Intergenic
900585458 1:3430473-3430495 CAGGGCAGACTTCAGGGGGAAGG - Intronic
901056439 1:6450619-6450641 GAGGGTAGGTATGAGGTGCAAGG - Intronic
901882907 1:12204436-12204458 TAGGGTAGCCGGGAGGTGGATGG - Intronic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902280277 1:15369346-15369368 TAGGGTAGAGAAGAGGAGGATGG - Intronic
902477907 1:16697866-16697888 GAGGGTAGGTATGAGGTGCAAGG + Intergenic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
904493921 1:30876482-30876504 CAGGGGAGGGATGAGGAGGATGG - Intronic
905352733 1:37358786-37358808 CAGGGGAGACTTCAGGGGGAAGG + Intergenic
905871595 1:41407535-41407557 CAGGGTGAACATGAGAAGGATGG - Intergenic
905989571 1:42323142-42323164 TATGGTAGAGGTGAGGTGGAAGG - Intronic
908055087 1:60277411-60277433 CAGTGTACTCATGAGGGGGAGGG + Intergenic
908780967 1:67689347-67689369 CAGGGGAGCCATAAGGGGGACGG - Intergenic
908990458 1:70081732-70081754 CAGGGCAGACATGGAGTGAAGGG - Intronic
909169154 1:72272253-72272275 CAGAGTAGAGATGGGGAGGAAGG - Intronic
909336528 1:74480997-74481019 CAGGGTACACATGAGTGGGAGGG + Intronic
910579225 1:88803137-88803159 GAGAGAAGAAATGAGGTGGAAGG + Intronic
913077215 1:115350958-115350980 CAGGCTGGACATGAGGCGGGAGG + Intergenic
914681766 1:149943898-149943920 CAGGGAAGAACTGAGGAGGAGGG - Exonic
915267743 1:154731095-154731117 CAGGGTTGCCAGTAGGTGGATGG - Intronic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
915679025 1:157561994-157562016 AAGGGAAGAAATGAGGTGGCAGG - Intergenic
916437204 1:164788071-164788093 GAGGGAAGAGATGAGGGGGAGGG + Intronic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
918882049 1:190137472-190137494 CATTATAGACAAGAGGTGGAGGG + Intronic
919545689 1:198915385-198915407 GAGTGTAGACATGACGTTGAGGG + Intergenic
920263603 1:204706259-204706281 CAGGGTACACAAGAGGGGGCTGG + Intergenic
920531913 1:206708275-206708297 CAGGGGAAACAAGAGGTGGCTGG - Intronic
921183076 1:212646530-212646552 CAGGGCTGACATGAAGTGTAAGG + Intergenic
922954537 1:229588008-229588030 CACAGAAGACATGAGGTGGCTGG - Intergenic
923546538 1:234927568-234927590 CAGAGTAGAGGTGAGGTGGAGGG - Intergenic
924116949 1:240757159-240757181 CAAGATAGACATCAGGTGAAAGG + Intergenic
1064136056 10:12751792-12751814 CAGGGAAGCCATGTGGTGGGCGG + Intronic
1065054058 10:21825448-21825470 CACAGTAGCCAAGAGGTGGAAGG - Intronic
1066043900 10:31579806-31579828 TAGGGTAGGAAAGAGGTGGATGG + Intergenic
1067297397 10:44982623-44982645 CTGGGCATCCATGAGGTGGAGGG - Exonic
1068044365 10:51867404-51867426 CAGTGTAGAGAAGAGATGGAAGG + Intronic
1069736822 10:70661992-70662014 CATGTTAAACATGAGCTGGAAGG + Intergenic
1069798080 10:71066007-71066029 CAGGTCAGAGATGATGTGGAGGG - Intergenic
1069798561 10:71068556-71068578 CAGGTCAGAGATGATGTGGAGGG + Intergenic
1070166752 10:73904660-73904682 CAAGGCAGACATGACTTGGATGG + Intergenic
1070525386 10:77291919-77291941 CAGGGCAGAGCTGAGCTGGAGGG - Intronic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071499540 10:86193587-86193609 CAGAGTTGACCTGAGCTGGAAGG - Intronic
1074827712 10:117226734-117226756 GAGGAGAGACAAGAGGTGGATGG + Intergenic
1075724602 10:124604904-124604926 CAGGGTAGAGAGGAGGCGGGTGG + Intronic
1075901915 10:126049973-126049995 CAGGGCAGAAAGGAGGTGGCTGG + Intronic
1076136953 10:128051755-128051777 CAGGGTAGAGACGCGGTGGAGGG + Intronic
1076669411 10:132111410-132111432 CCAGGTAGACATGGGGTGAATGG + Intronic
1076988029 11:253405-253427 CAGAGTGAACATTAGGTGGAAGG + Intergenic
1079346571 11:19657638-19657660 CAGGGTAGACCAGATGTGGAGGG + Intronic
1080246951 11:30189980-30190002 GAGGGTAGAGATCAGGAGGAGGG - Intergenic
1080695937 11:34603043-34603065 CAGGGAAGACAAGAGGAGAAGGG - Intergenic
1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG + Intergenic
1082761062 11:57127355-57127377 AAAGGTAGACATGAGCAGGAAGG + Intergenic
1085122564 11:73976621-73976643 CAGGTGAGTCATGAGGTAGACGG - Exonic
1085251705 11:75148207-75148229 CAGGACAGGCCTGAGGTGGAGGG + Intronic
1085645389 11:78219164-78219186 CAGAGTAGAGAGGAGGTGGATGG + Exonic
1087647590 11:100826748-100826770 CAGGGGTGACATGAGCAGGAAGG - Intronic
1087743833 11:101919851-101919873 CAGGGCCAACATGAGGTTGAGGG - Intronic
1087815875 11:102658147-102658169 TAGGGAAGAAAGGAGGTGGAGGG + Intergenic
1088114918 11:106302887-106302909 TTGGGTTGCCATGAGGTGGAGGG + Intergenic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1088750658 11:112839642-112839664 CAGTGTACACAGGAGGTGGCAGG + Intergenic
1089069699 11:115689875-115689897 CAGCGGAGACATGAGGGAGAAGG + Intergenic
1089376658 11:117999604-117999626 CAGGCTAGAGATGAGGGGCAGGG - Exonic
1089651426 11:119916311-119916333 AATGGTAGACAAGAGATGGATGG + Intergenic
1089723633 11:120453071-120453093 CAGGGTGGAGATGAGATGAATGG - Intronic
1090077288 11:123587418-123587440 CCTAGTAGACATGAGATGGAGGG + Intronic
1090519442 11:127462478-127462500 TAGGATAGAGAAGAGGTGGAAGG - Intergenic
1090933881 11:131324478-131324500 AAGGAGAGACATGAAGTGGAAGG - Intergenic
1092931927 12:13324077-13324099 CAGGGTATTTATGAGGAGGAGGG - Intergenic
1097325320 12:58270080-58270102 CATGTGAGCCATGAGGTGGAGGG - Intergenic
1097841523 12:64326207-64326229 CAGGGTAGAGAGGAGGGGGGTGG + Intronic
1099945597 12:89240225-89240247 AAGGGTAGTCAGGAGTTGGAGGG - Intergenic
1100423082 12:94456718-94456740 CAGGGAAGAGACCAGGTGGAGGG - Intronic
1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG + Intronic
1101777468 12:107807345-107807367 CAGGGTGGAAATGAGGTTGAAGG + Intergenic
1102471716 12:113163202-113163224 CAGGGGAGCCAAGAGGCGGAGGG - Exonic
1106532873 13:30610418-30610440 CAGGGTTTAGATGAGGTGGAAGG + Intronic
1107272489 13:38636288-38636310 CAGGGCAGCCACGTGGTGGAAGG - Intergenic
1108395938 13:49991712-49991734 CAGGGTGGAGATGAGGAGCATGG - Intergenic
1116551333 14:46242854-46242876 CAGGGTAGAGATAAGATAGATGG + Intergenic
1116817720 14:49599154-49599176 CAGGGTGGAGATGAGCAGGAAGG - Exonic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117666753 14:58063715-58063737 CAAGGAAGACATGAGCTGGGAGG - Intronic
1118979269 14:70702877-70702899 AAGGGCAGACATGTGGTGGTGGG - Intergenic
1119758941 14:77138127-77138149 CAGGGTAGGGAGGAAGTGGAAGG + Intronic
1120501606 14:85304029-85304051 ATAGGAAGACATGAGGTGGAAGG - Intergenic
1122849027 14:104516705-104516727 CAGGGTAGGCAGGAGGCTGAGGG + Intronic
1123113134 14:105882242-105882264 CAGGGTGGAGAGGAGGTGGGCGG + Intergenic
1123115480 14:105892392-105892414 CAGGGTGGAGAGGAGGTGGGCGG + Intergenic
1124129195 15:26970121-26970143 CTGGATAGGCATGAAGTGGAGGG - Intergenic
1124890146 15:33725277-33725299 AAGGGTAGAGAAGAGGTGGTTGG - Intronic
1125195841 15:37045139-37045161 TAGGGCAGAGTTGAGGTGGAGGG - Intronic
1125649482 15:41303155-41303177 CAAGATAGACATCAGGTGAAAGG - Intergenic
1126197848 15:45951642-45951664 CAGGGTAGAGGTGAGGGGTAGGG + Intergenic
1127862637 15:63007112-63007134 CAGGGTGGACATGAGTTTGGGGG - Intergenic
1128904110 15:71452119-71452141 GTGGTTAGGCATGAGGTGGATGG - Intronic
1129165434 15:73774591-73774613 CAGGGGTGAGAGGAGGTGGACGG - Intergenic
1129224997 15:74164199-74164221 CAAGGTAGAGAGGAGCTGGAGGG - Intergenic
1129491142 15:75926742-75926764 AAGGATAGGCATGAGGTGAATGG + Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130392951 15:83474939-83474961 CTGGCAAGAAATGAGGTGGAGGG + Intronic
1132709487 16:1260060-1260082 CAGGGCAGAGAAGAGGTGGAAGG - Intergenic
1133085241 16:3357099-3357121 CAGGGGAGACATGTTGTTGAGGG + Exonic
1134199049 16:12182547-12182569 CAGGGTAGTACTGAGGTGGCAGG + Intronic
1135183081 16:20291920-20291942 CAGGGGAGAGAGGAGGGGGAGGG + Intergenic
1136035230 16:27534202-27534224 CACGGTAGAAATGAGATGGAAGG - Intronic
1136271836 16:29153275-29153297 CAAGGCTGACATGAGCTGGAGGG - Intergenic
1136499858 16:30664762-30664784 CAGGGTGGCCCTGAGGTGGTGGG + Exonic
1137610457 16:49814070-49814092 CAGGGAAGGCGTGAGGTCGAAGG + Intronic
1137869078 16:51932207-51932229 CAGGTTGGAGATGGGGTGGAAGG - Intergenic
1138598854 16:58043409-58043431 CTGGGTAGGCCTGAGGTTGAGGG - Intronic
1139256373 16:65546796-65546818 AATGATAGAAATGAGGTGGAGGG + Intergenic
1141000728 16:80305026-80305048 CACAGTGGTCATGAGGTGGAAGG - Intergenic
1141659491 16:85434353-85434375 CCGGGTATACAGGAGGCGGACGG - Intergenic
1141727555 16:85799750-85799772 CAGGTGAGACAGGAGGTGGCCGG + Exonic
1142075502 16:88115431-88115453 CAAGGCTGACATGAGCTGGAGGG - Intronic
1142183757 16:88684885-88684907 CAGGATAGACCTGAGGTGCTGGG - Intronic
1144046265 17:11457235-11457257 CAGGGTAGAGATGAGTGGCAGGG - Intronic
1144422846 17:15113855-15113877 CAGGGAAGAGATGAGGAGGCTGG + Intergenic
1144766917 17:17738038-17738060 GTGGGTGGGCATGAGGTGGACGG + Intronic
1146018155 17:29249965-29249987 CAGAGTAGGGATGAGGTGGAGGG - Intronic
1147555630 17:41477147-41477169 CAGGGAAGGCATGACTTGGAGGG + Exonic
1147742410 17:42676649-42676671 CAGGGGAAAGATGAGGTGGGAGG + Exonic
1147995622 17:44358839-44358861 AGGGGGAGACATCAGGTGGAGGG - Intronic
1148845061 17:50525043-50525065 CAGGGCACACATGAGGGGGCAGG - Intronic
1148977068 17:51538928-51538950 TGGGGTAGACATGAGGGAGAGGG + Intergenic
1149996574 17:61408955-61408977 CAGTGTAGACCTGAGCTGGGAGG + Exonic
1151630841 17:75309731-75309753 CTGGGAAGACCTGGGGTGGAGGG - Intergenic
1156374536 18:36501466-36501488 CAAGGGAGGCATGAGGTAGAAGG + Intronic
1158861916 18:61600881-61600903 CAGGTTAGAGAGGGGGTGGAAGG + Intergenic
1160623526 18:80187609-80187631 CAGGGGAGCCAGGAGGTGGATGG - Intronic
1163379570 19:16956208-16956230 CATGGTTGAAATGAGATGGAAGG - Intronic
1163388552 19:17015509-17015531 CAGAGCAGACAGGAGGTGGGTGG - Intronic
1163531073 19:17849185-17849207 CAGGGGTGAGATGAGGGGGAAGG + Intergenic
1164696013 19:30245002-30245024 CTAGGTAGACATGAGTTAGATGG - Intronic
1164855048 19:31514125-31514147 CAGGGCAGAAATGACGTGCACGG - Intergenic
1165396520 19:35567178-35567200 CAGGGTGGACATGGTGGGGAGGG + Intergenic
1165871547 19:38976308-38976330 CAGGGGAGTCCTAAGGTGGAAGG - Intergenic
1168191216 19:54739987-54740009 CAGGGTAGACATGAGGTGGAGGG - Intronic
1168193476 19:54756592-54756614 CAGGGTAGACATGGGGTGGAGGG - Intronic
1168195539 19:54771330-54771352 CAGGGTAGACATGGGGTGGAGGG - Intronic
1168199479 19:54804515-54804537 CAAAGTAGACATGGGGTGGAGGG - Intronic
1168203921 19:54835560-54835582 CAGGGTAGACATGAAGTGGAGGG - Intronic
925089063 2:1138540-1138562 CAGCTGAGAGATGAGGTGGAGGG + Intronic
925100348 2:1238884-1238906 CAAGGGAGACGTGAGGTGGTGGG - Intronic
925144841 2:1574324-1574346 CAGGGCAGACAGGCGGTGAAGGG + Intergenic
925997747 2:9306142-9306164 GGGTGTAGACATGGGGTGGAGGG + Intronic
926245551 2:11120330-11120352 CAGGTTAGATTAGAGGTGGACGG - Intergenic
926757819 2:16250215-16250237 CAGAGTGGAGGTGAGGTGGAGGG + Intergenic
927446352 2:23165455-23165477 CAGGGGAGAAATGAGGTCGGGGG + Intergenic
927638221 2:24831345-24831367 CTGGGTAGAGAGGAAGTGGAGGG - Intronic
927809797 2:26174487-26174509 CAGAGTTGGCATGAGGTGGCCGG - Intronic
928945157 2:36765540-36765562 CAAGGGAGGGATGAGGTGGAAGG - Intronic
929277059 2:40037295-40037317 GAGGGTAGACGAGAGGTTGAGGG + Intergenic
929768969 2:44875420-44875442 CTGGGAAGGCATGAGGTGGTTGG + Intergenic
934041571 2:88131361-88131383 CAGGGTAGGCAGGAAGTGCAGGG - Intergenic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
938314712 2:130317702-130317724 GAGGGAAGGCATGAGGGGGAGGG - Intergenic
939129709 2:138220102-138220124 CAGGGGAGACATGAGGCTGTGGG + Intergenic
939433431 2:142141453-142141475 CATGGTGGACAAGAGGAGGAAGG + Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
947507746 2:230722490-230722512 CAGTGTAGAGATGAGATGGGAGG + Intronic
947586152 2:231358173-231358195 CAGGGTATGAATGAGGGGGAGGG + Intronic
948256813 2:236574384-236574406 CCTGGTAGGAATGAGGTGGAGGG + Intronic
948623104 2:239249150-239249172 CGAGGTACACACGAGGTGGAGGG + Intronic
948860553 2:240750728-240750750 CACAGGAGACAGGAGGTGGAGGG + Intronic
1169059341 20:2650040-2650062 CAGGGTAGACAAGATGCAGATGG + Intergenic
1169907517 20:10618424-10618446 TAGGGTGGACATGAGGCAGATGG + Intronic
1174872602 20:54197135-54197157 CTGCGAAGACATGAGGAGGAGGG - Intergenic
1176386638 21:6141306-6141328 CAGAGTAGAGCTGGGGTGGATGG - Intergenic
1178120764 21:29467790-29467812 CAGGGTAGCACTGAGTTGGAAGG + Intronic
1178668481 21:34569545-34569567 CAGGGTAGGCAGGTGGAGGAAGG - Intronic
1179736835 21:43396946-43396968 CAGAGTAGAGCTGGGGTGGATGG + Intergenic
1179951563 21:44711503-44711525 CAGGGCAGACATGAGGGGCTTGG + Exonic
1183375652 22:37463405-37463427 CAGGGTAGACGTGGGGAGGGAGG + Intergenic
1184075310 22:42173363-42173385 CAGGGTCAACATCAGGTGGGGGG + Intronic
1184663320 22:45975556-45975578 CGGGGCAGACATGGGATGGAGGG + Intronic
1185128194 22:49023300-49023322 CAGGGTAGACAGGAGGGGAGAGG + Intergenic
950584715 3:13883955-13883977 CAGGGTAGACAGGATAAGGAAGG + Intergenic
951658630 3:25037354-25037376 CAGGGCAAACATGGGGTGGAGGG + Intergenic
951702451 3:25509943-25509965 CAGGGTGGACAGGAGTTGGTTGG - Intronic
954626159 3:52023017-52023039 CAGGGCAGACAGGAGCTGCAGGG - Intergenic
954631405 3:52049644-52049666 CTGGGGAGACATTAGGTGGTGGG - Exonic
955617405 3:60823826-60823848 CAGGGAAGATTTGAGGTGCAGGG + Intronic
956846088 3:73184131-73184153 CAGGGACTACTTGAGGTGGAGGG - Intergenic
960470545 3:118059615-118059637 CAGAGAAGATATGAGGTAGAGGG - Intergenic
961036316 3:123644424-123644446 CAGGGGAGGCATGGGGTGGAGGG + Intronic
963507613 3:146206720-146206742 CTGGGTAGCCAGTAGGTGGAGGG + Exonic
964464930 3:156981352-156981374 CAGGGTAGACTGGAGATGCAGGG + Intronic
965374471 3:167905898-167905920 CAAGGTAGACATGACGTTCAAGG + Intergenic
967860632 3:194148773-194148795 CTGGGTAGAGATGCGGGGGAGGG - Intergenic
969365138 4:6689919-6689941 CAGGGTGGAGATGGGCTGGAGGG - Intergenic
969722251 4:8898567-8898589 CAGGCTACAGATGATGTGGATGG - Intergenic
970525414 4:16927181-16927203 CTGGGTGGACATCAGGTGGCAGG + Intergenic
971195013 4:24464834-24464856 CAGGAGAAACATGCGGTGGAGGG - Intergenic
971308789 4:25506351-25506373 CAGGGACGGCATGGGGTGGAAGG - Intergenic
971884516 4:32425970-32425992 CAGGGTAGAGATCTGGTGGAAGG + Intergenic
972287861 4:37665867-37665889 CAGGGTAGAAATGACTTGGCTGG - Intronic
972833714 4:42843321-42843343 CAGAGAGGACAGGAGGTGGAGGG - Intergenic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
975463093 4:74677473-74677495 AAGGGTAGACATTGGTTGGAGGG - Intergenic
976700293 4:87962639-87962661 CAGGGTAGGGATGAGGGTGAAGG + Intergenic
978295977 4:107205672-107205694 CAGGACAGAGATGAAGTGGATGG - Intronic
979469281 4:121074753-121074775 GAGGGTAGACAGGAGCTGGAAGG + Intergenic
981728767 4:147875499-147875521 GAGGGTAGAGGTGAGGGGGAAGG - Intronic
983564290 4:169133130-169133152 TGGTGTAGACATGAGCTGGAAGG + Intronic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985626545 5:991860-991882 CAGGATGGAGATGAGGTGTACGG - Intergenic
986335599 5:6752961-6752983 CGGGGAAGACATGTGGTGGACGG - Exonic
986705750 5:10453332-10453354 CTGGGTAGACAGGAGGTGCTCGG + Intronic
987252922 5:16118854-16118876 CAGGGCAGTGAAGAGGTGGAAGG + Intronic
988368819 5:30339993-30340015 CATGGTAGACATCAGGCAGATGG - Intergenic
988914205 5:35876049-35876071 CAAGCTAGAGATGAAGTGGAAGG + Exonic
989756506 5:44961842-44961864 CAGGGTAGACTTCAGGTTGCAGG + Intergenic
990569506 5:57063926-57063948 CAGGGTGGCCAAGAGGTGAAGGG + Intergenic
994259559 5:97641196-97641218 CAGGGTAGAGATGGTGTGGGAGG + Intergenic
998218688 5:140257329-140257351 CAGAGTAGTAATGAAGTGGAGGG - Intronic
998417316 5:141955386-141955408 CAGGGTCGGGGTGAGGTGGAAGG + Exonic
999902182 5:156096324-156096346 CAGGGATGAAATGTGGTGGAAGG + Intronic
1000335031 5:160235710-160235732 CAGGGAAGACATGATGAGGGAGG + Intronic
1002472521 5:179444729-179444751 CAGGGTGGATATTAGGTTGAAGG - Intergenic
1006178891 6:32141824-32141846 CGGGGTACAGATGAGGTGGCAGG + Intergenic
1006237080 6:32642923-32642945 CAGGGCAGACATGAGATCAATGG - Intronic
1006247062 6:32746553-32746575 CAGGACAGACATGAGATCGATGG - Intronic
1006334630 6:33414176-33414198 CAGGGGAGTCCTGAGGTGGGAGG - Intronic
1007720898 6:43884917-43884939 CTGGGGAGACATGGGTTGGATGG - Intergenic
1009393152 6:63166519-63166541 CAGGGCAGAGATGAGGTATAGGG - Intergenic
1011989512 6:93496505-93496527 CAGTGGACACATGAGGTGCAAGG - Intergenic
1012268709 6:97180432-97180454 CAGGGTAGAGAGGATGGGGATGG + Intronic
1013423390 6:109987333-109987355 CAGGCTTGACAGGAGGAGGATGG + Intergenic
1017688286 6:156935786-156935808 GAGTGTAGACATCAGTTGGAAGG + Intronic
1017715437 6:157207711-157207733 TAGCGTAGACATGATGTGCAGGG + Exonic
1018640149 6:165897911-165897933 CTGGGTGGACATGAGGTGAGAGG - Intronic
1018787758 6:167121548-167121570 GATGGTAGAAATGAGGAGGAGGG + Intergenic
1019346170 7:531764-531786 CAGGGGAGCCACGAGGCGGAGGG + Intergenic
1019372197 7:668345-668367 CAGGGGAGACATCACGTGAAAGG + Intronic
1019557722 7:1641005-1641027 CTGGGAAGAGAGGAGGTGGAGGG - Intergenic
1019710936 7:2517992-2518014 CAGGGAAGAGATGATGGGGATGG + Intronic
1022203329 7:28138990-28139012 CAAGGTAGACCTGAAGTGGAGGG + Intronic
1022342955 7:29486020-29486042 CAGGCTGGGCAGGAGGTGGAAGG - Intronic
1022797314 7:33742429-33742451 CAGGGTAGGCAGGAGGTTAATGG + Intergenic
1023049715 7:36240401-36240423 CAAGATAGAAATGAGGTTGAGGG - Intronic
1025969653 7:66310420-66310442 AAGTCCAGACATGAGGTGGATGG - Intronic
1029288916 7:99486724-99486746 CAGGGCAGATATGATGAGGATGG + Exonic
1029794044 7:102875326-102875348 AAGGGGAGAGAAGAGGTGGAGGG + Intronic
1032433127 7:131879214-131879236 CAGGGCAGCCATGAGGAGTAAGG + Intergenic
1032519530 7:132533508-132533530 CAGGGGAGTCCTGATGTGGATGG - Intronic
1033454645 7:141491862-141491884 CAGGGGAGAGATGAGGAGGCAGG - Intergenic
1034412721 7:150949727-150949749 CAGGGTAGAAAGGAAGTGGGGGG + Intronic
1035458607 7:159025319-159025341 CAAGGGAGAGATGAGGAGGAGGG - Intergenic
1035613926 8:988680-988702 CAGGGAACACATCAGATGGAAGG - Intergenic
1036076958 8:5512796-5512818 CTGGGGTGACAGGAGGTGGAAGG + Intergenic
1036169037 8:6465390-6465412 CGGGGTGGACATGGGGTGGTGGG - Intronic
1039514544 8:38120956-38120978 ATGGGTAGCCATGAGGGGGAAGG - Exonic
1039623684 8:39025400-39025422 CAGGGTGAACATGAGGAGTAAGG - Intronic
1048303104 8:133265831-133265853 CAGGGTAGGCATGGGGTGAAGGG - Intronic
1048417796 8:134245905-134245927 TAGGGTAGACATGTGGTGTATGG - Intergenic
1049770256 8:144376817-144376839 CTGGGTAGGCAGCAGGTGGATGG + Intronic
1057797936 9:98171676-98171698 AAGGGGAGGCATGGGGTGGAAGG + Intronic
1058545071 9:106052532-106052554 GTGGGTAGACGAGAGGTGGATGG - Intergenic
1060520609 9:124292013-124292035 GAGGGCAGACATGAGGTGCCTGG - Intronic
1061098229 9:128472561-128472583 CAGTGTAGAGAAGAGGTAGAAGG + Intronic
1062079952 9:134618571-134618593 CAGGGTGGACATGAGGCTGCGGG + Intergenic
1062421984 9:136487049-136487071 CAGGGCTGACATGAGGCTGAAGG + Intergenic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1186988007 X:15037372-15037394 CGGGGTAGAAATGAAGTGTAGGG - Intergenic
1188355184 X:29182108-29182130 CAGGGAAGGCATGGGGTGGGGGG - Intronic
1188523928 X:31070085-31070107 CAGTGAAGACATGTGGTGGATGG + Intergenic
1188857321 X:35212119-35212141 CTGTGTAGAATTGAGGTGGAAGG + Intergenic
1189812856 X:44797275-44797297 TAGGGTAGAGCTGAGGTGGGAGG - Intergenic
1192146423 X:68686001-68686023 GGGGGCAGACAGGAGGTGGAGGG + Intronic
1192738901 X:73874670-73874692 CAGGGAAGAAATGAGGAGGGAGG + Intergenic
1194940721 X:100006733-100006755 CAGGGTAGACATAAGTTGTGAGG + Intergenic
1198617775 X:138478293-138478315 CAGGGTGGAAATCAGGTTGAGGG - Intergenic
1202596606 Y:26547410-26547432 CAGGGCATACGAGAGGTGGAAGG + Intergenic