ID: 1168198242

View in Genome Browser
Species Human (GRCh38)
Location 19:54791568-54791590
Sequence CATGATGCTCACATTGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168198236_1168198242 11 Left 1168198236 19:54791534-54791556 CCAGGAGTAGACAGCACGGCCAA 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1168198242 19:54791568-54791590 CATGATGCTCACATTGCTGTGGG 0: 1
1: 0
2: 1
3: 16
4: 203
1168198239_1168198242 -8 Left 1168198239 19:54791553-54791575 CCAAGCTCCTGGGTTCATGATGC 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1168198242 19:54791568-54791590 CATGATGCTCACATTGCTGTGGG 0: 1
1: 0
2: 1
3: 16
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168198242 Original CRISPR CATGATGCTCACATTGCTGT GGG Intronic
902775912 1:18674851-18674873 GATGATGCTGCCACTGCTGTTGG - Intronic
902802715 1:18840282-18840304 CCTGATGCTGACACTGCTGCTGG - Exonic
902892919 1:19457676-19457698 CCTGATGCTCACACTGCGGACGG + Intronic
905843177 1:41202862-41202884 CATTATGCTTATATTTCTGTTGG - Intronic
907000142 1:50844601-50844623 CATTATGTTGACACTGCTGTGGG - Intronic
907876794 1:58497286-58497308 CATGATCCACACATTGCATTTGG - Intronic
910108580 1:83657773-83657795 CATGATGCTGACATGGCTTAGGG - Intergenic
913331112 1:117668533-117668555 CACCATGCTCACATAGATGTTGG - Intergenic
916764921 1:167850896-167850918 CATGAAGCTCACATTCTAGTGGG + Intronic
917471418 1:175329030-175329052 CAGGCTGATCTCATTGCTGTTGG + Intronic
918127648 1:181598332-181598354 CATTATGGACCCATTGCTGTGGG + Intronic
918444604 1:184604696-184604718 CATGATGATGACACTGGTGTAGG + Intronic
920446112 1:206019490-206019512 AATGCAGCTGACATTGCTGTGGG + Intronic
921389280 1:214603311-214603333 CAGGACGCTCACCTTGCTCTCGG - Exonic
923235372 1:232027989-232028011 AATGATTTTCACATTGCTTTAGG + Intronic
1064573414 10:16719654-16719676 CATGAGGCTTACAGTGCAGTTGG - Intronic
1065118445 10:22505011-22505033 CCTGATGTACACATTGCTGATGG - Intergenic
1066548976 10:36534147-36534169 TATGAGGCTCCCAGTGCTGTAGG - Intergenic
1069390259 10:67927872-67927894 CATGGTGCTTACATTGTGGTGGG + Intronic
1069639632 10:69946301-69946323 CATGGCGCACACATTGCTGAGGG - Intronic
1070699865 10:78593837-78593859 GATGATGCCCACATTGGTGAGGG + Intergenic
1071672220 10:87619221-87619243 CATGGTGCTCACAGTGCAGTGGG - Intergenic
1074448386 10:113539100-113539122 CATGAGGCTCACATTCCTGCAGG + Intergenic
1077926432 11:6686148-6686170 CATGCTGTTAGCATTGCTGTAGG - Intergenic
1078868063 11:15316862-15316884 GATGATGCTAACATTTCTGAAGG + Intergenic
1079351626 11:19696723-19696745 CAAGATGCTGACATTGCAGCAGG + Intronic
1079460825 11:20676363-20676385 CATGGAGCTCGCATTCCTGTGGG - Intronic
1080717391 11:34817583-34817605 CATGAAGCTCACATTCTAGTGGG - Intergenic
1083468429 11:62865022-62865044 CATGATTCCCACATTACAGTGGG - Intronic
1085516307 11:77113859-77113881 CATTATGATCACAGTGCTATGGG + Intronic
1087018923 11:93582592-93582614 AATGATGATCACGTGGCTGTAGG + Intergenic
1087071103 11:94081749-94081771 CATGAAACTCACATTGCAGTAGG + Intronic
1088589440 11:111390722-111390744 CAAGATGCTCAGAGTCCTGTTGG - Intronic
1093055629 12:14553231-14553253 CATGATGATCTCATTGCTCAGGG + Exonic
1093939968 12:25042391-25042413 CATGATGATAAAATTTCTGTGGG + Intronic
1095992141 12:48042468-48042490 CTTGGTGCTAACATTGCTGGGGG + Intergenic
1096934828 12:55260448-55260470 CATGATTTTTACAGTGCTGTTGG + Intergenic
1097395322 12:59066345-59066367 CATGCTGTCCACATGGCTGTTGG - Intergenic
1097577149 12:61409161-61409183 CATGATGAGCACATTGATGCTGG - Intergenic
1097722787 12:63041561-63041583 CATGATACTCACATTGGTGAAGG + Intergenic
1098115481 12:67171972-67171994 CAAGATGCTCATATTGATGAGGG - Intergenic
1100016398 12:90015800-90015822 CATGTTGCTCTGATTGCTGCTGG + Intergenic
1101431260 12:104629335-104629357 CTTGAAGCTCACATGGTTGTTGG + Intronic
1101615193 12:106329354-106329376 CATGAGGCTGACCTTGCTTTTGG + Intronic
1103699515 12:122841617-122841639 CATGATCCTCAAACTGCAGTAGG + Intronic
1104915294 12:132261303-132261325 CATGATGCTGACATTCCAGTGGG + Intronic
1105984750 13:25554426-25554448 CATGATTCTCACCTTGCTGACGG - Intronic
1106814612 13:33393381-33393403 CACCATGCTGACATTGCTTTTGG - Intergenic
1107765792 13:43733138-43733160 CATAATGCTCACGGTGTTGTGGG - Intronic
1111444841 13:88333932-88333954 CATGATGTTCACACATCTGTAGG + Intergenic
1112168863 13:96948676-96948698 CATGAAGACGACATTGCTGTGGG + Intergenic
1112680964 13:101764318-101764340 CTTGATCCTCACAATTCTGTGGG - Intronic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1115749058 14:36469966-36469988 AATGGTGTTCTCATTGCTGTTGG + Intergenic
1116700846 14:48239562-48239584 CATGATAATCACATTTCTTTTGG - Intergenic
1117294680 14:54368414-54368436 CATGTTGTATACATTGCTGTTGG - Intergenic
1117555625 14:56880269-56880291 CATGAAGCTTACATTCCAGTGGG - Intergenic
1118064701 14:62178486-62178508 CATGTTCTTCACATTGCAGTAGG + Intergenic
1120010314 14:79406192-79406214 TATGTTGCTGACATAGCTGTGGG - Intronic
1122523952 14:102366779-102366801 CATGTTGCTTACATTCTTGTAGG + Intronic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1124603568 15:31153746-31153768 CATGTGGCTCACACTGTTGTTGG - Intronic
1126836083 15:52666782-52666804 CATGAAGCTTATATTCCTGTTGG + Intronic
1131563807 15:93467504-93467526 CAAGATGGTCACATGGCTGCTGG + Intergenic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1133117032 16:3583233-3583255 CATGATGCTTCCTTTGATGTCGG + Exonic
1135965274 16:27030143-27030165 GAGGTTGCTCACATGGCTGTTGG - Intergenic
1138855636 16:60687905-60687927 TTTGATTCTCACATTGCTGTCGG - Intergenic
1140063539 16:71591183-71591205 CATGAAGCTGACATTCTTGTTGG + Intergenic
1140267401 16:73432696-73432718 CCTGATGCTGACATTGCTGTGGG - Intergenic
1143563152 17:7706956-7706978 CCTGATACTCACATTGCAGCTGG - Intronic
1147484667 17:40801153-40801175 GATGATGATCAGATTGATGTGGG + Intergenic
1148773111 17:50078234-50078256 CATGATCCTCACTCTGCTGGTGG + Exonic
1149206727 17:54256423-54256445 TATTATGCTCACAATGTTGTTGG + Intergenic
1149693637 17:58599188-58599210 CATGTTGTTCAAATTGCTCTTGG + Exonic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1155554750 18:27006408-27006430 CATGACCCACACATTGCTGGAGG - Intronic
1156954451 18:42944373-42944395 CATGAAGCTTACATTGTAGTGGG - Intronic
1157968657 18:52239602-52239624 CATGATGCTTCCATTCCTATAGG - Intergenic
1158112169 18:53952272-53952294 CATTATGCTTACATTTCAGTGGG + Intergenic
1158422362 18:57306504-57306526 CATGATGCTCAGAGTACAGTGGG - Intergenic
1160702880 19:517131-517153 CATGAAGCTCACAGGGATGTGGG + Intronic
1160910699 19:1472554-1472576 CATGTTGCGCACCTTGCTGCTGG - Exonic
1162321071 19:9970815-9970837 CAAGCTGCTCACATTCCTGGGGG + Intronic
1163014182 19:14443599-14443621 CTTGGTGCTGCCATTGCTGTAGG - Exonic
1164786888 19:30939478-30939500 CTTTTTGCTCACATTGCTTTGGG + Intergenic
1168198242 19:54791568-54791590 CATGATGCTCACATTGCTGTGGG + Intronic
926586595 2:14692614-14692636 TATGAGATTCACATTGCTGTGGG + Intergenic
930349411 2:50230861-50230883 AATGATGGTCACATTTCTATTGG - Intronic
934494676 2:94787265-94787287 CAAGAAGCCCACAGTGCTGTAGG + Intergenic
937344542 2:121116529-121116551 CATGATCCTGAAATTGCAGTGGG - Intergenic
938294073 2:130166439-130166461 CATGATGCCCAGATGGCTCTTGG - Intronic
938301962 2:130221729-130221751 GATGATGCCCACATTGGTGAGGG - Intergenic
938454739 2:131452723-131452745 GATGATGCCCACATTGGTGAGGG + Intergenic
938462573 2:131507447-131507469 CATGATGCCCAGATGGCTCTTGG + Intergenic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
939515110 2:143156642-143156664 CATGTTCCTGAGATTGCTGTGGG - Intronic
944081715 2:195795801-195795823 CATGATGCTTACATTCTAGTGGG + Intronic
944452948 2:199861599-199861621 CATGATGATGACAGTGATGTAGG - Intergenic
944976591 2:205060146-205060168 CATTATGCTGCCATTGCTTTGGG + Intronic
945858929 2:215098640-215098662 AGAGATGCTCACCTTGCTGTTGG - Intronic
947362435 2:229360010-229360032 CATTGTGCTCACATAGATGTGGG + Intronic
1168983664 20:2028751-2028773 CATCATGGTCACATTGCTGATGG + Intergenic
1174286700 20:49479211-49479233 CATGGTACTCACATTCTTGTGGG + Intronic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1177321690 21:19530027-19530049 AATGATGCTCACATGGCAGACGG + Intergenic
1180420568 22:12810701-12810723 CAGGATGCTCCCATTGTTTTGGG - Intergenic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1181691380 22:24563513-24563535 CATGTTGGTCAAAATGCTGTTGG + Intronic
950165559 3:10794871-10794893 CATGATGCTTACAGTCCAGTGGG + Intergenic
950528594 3:13539470-13539492 CATGGAGCTCACATTCCAGTGGG - Intergenic
950709738 3:14805727-14805749 CATGCTGCACACATTGCTGGAGG - Intergenic
952144436 3:30516645-30516667 CATGATACTTACAATGCTTTAGG + Intergenic
952373332 3:32744119-32744141 CATAAAGCTCACAATGCAGTTGG + Intronic
953036215 3:39213394-39213416 CATGAAGCTAACATTCCTATGGG + Intergenic
954406372 3:50347571-50347593 CTGGATGGACACATTGCTGTGGG - Exonic
956545479 3:70396507-70396529 CATGATTCTGACATTGTTCTAGG + Intergenic
960048839 3:113221893-113221915 CAGGAGGCTAACATGGCTGTGGG - Intronic
960099001 3:113718174-113718196 CCTGATGCTCACGTGGCTCTTGG - Exonic
962023489 3:131524929-131524951 CAGGATGATAACATTCCTGTCGG + Intergenic
963025784 3:140917540-140917562 CATGTTGCTCACATTTTTGTGGG - Intergenic
965296988 3:166960023-166960045 CATGATGCTTGCTTTTCTGTAGG - Intergenic
965785712 3:172332455-172332477 CAAGAAGCTCACATTCCAGTGGG - Intronic
968194220 3:196693686-196693708 CGTGGAGCTCACATTTCTGTCGG - Intronic
968254390 3:197253426-197253448 GATCATTCACACATTGCTGTTGG + Intronic
968483991 4:849996-850018 CACGCTGCACACAGTGCTGTGGG - Exonic
970299857 4:14669793-14669815 CATGATTCTGACATTGTTTTAGG - Intergenic
971327156 4:25654135-25654157 CGTGCTGCACACACTGCTGTCGG - Intergenic
973220580 4:47721701-47721723 CATAATCCTCACAGTGCTGCTGG + Intronic
973361179 4:49166387-49166409 CAGGATGCTCCCATTGTTTTGGG + Intergenic
973361207 4:49166562-49166584 CAGGATGCTCCCATTGTTTTGGG + Intergenic
973631812 4:52826645-52826667 CATGGTGCTCACAGTCCAGTGGG - Intergenic
973684892 4:53359771-53359793 CATGATGCTCACATTTTTAATGG - Intronic
973843364 4:54885695-54885717 CATTATGCTTACTTGGCTGTAGG - Intergenic
974700934 4:65445512-65445534 TATAATGCTCACAGTCCTGTTGG - Intronic
976920466 4:90434978-90435000 CATGATCCTGACATGGCTGGAGG - Intronic
977297672 4:95228987-95229009 CATGATAATCACATTGCATTTGG + Intronic
977803630 4:101269749-101269771 CATGATGTTCACATTGAGGTGGG - Intronic
980704533 4:136475798-136475820 AATCATTCTCACATTGATGTGGG + Intergenic
984067131 4:175062405-175062427 CACTATGCCCACATTCCTGTGGG - Intergenic
985391495 4:189495677-189495699 CATGCTCCTTACACTGCTGTGGG + Intergenic
988858434 5:35252155-35252177 CATAATCCCCACATTGTTGTGGG - Intergenic
992919148 5:81494557-81494579 CATAATGCTCACATGGCAGAAGG - Intronic
994302715 5:98164973-98164995 CATGATGCTTACAGTTTTGTGGG + Intergenic
995195799 5:109366643-109366665 CATGAAGCTTACATTGTAGTAGG - Intronic
996245817 5:121263060-121263082 CACCATGCTCACACTGCTGCTGG - Intergenic
996369969 5:122742773-122742795 CATGAAGCTCACATTTAAGTAGG - Intergenic
996803135 5:127425852-127425874 CCTGTTGCTGAGATTGCTGTAGG + Intronic
997408331 5:133670047-133670069 CAAGATGCCCACACTGCTGTAGG + Intergenic
997900290 5:137757145-137757167 CATGATGCTTACATTCTAGTGGG + Intergenic
997991956 5:138551965-138551987 CATGCTGTTCAGAGTGCTGTAGG + Intergenic
998499047 5:142616039-142616061 CATGATGCTCACGAAGCTGCTGG - Intronic
998812614 5:145981441-145981463 CAAGATCCACACATTGCAGTTGG + Intronic
999095744 5:148976588-148976610 CATGGTGCTCACATTCTAGTGGG - Intronic
999138847 5:149343562-149343584 CATGAAGCTCACATTCTAGTTGG + Intergenic
1000665352 5:163988321-163988343 CATGATGAAAACAGTGCTGTGGG + Intergenic
1002770077 6:282880-282902 CATGATGCTCAGAGAGATGTGGG + Intergenic
1003013476 6:2448827-2448849 CATCATGTTCACATTACTATGGG + Intergenic
1003203285 6:3983731-3983753 CATGATTCCCACATGTCTGTGGG + Intergenic
1003961407 6:11212426-11212448 GGTGATGCTTACATTGCCGTGGG - Intronic
1004790410 6:19020062-19020084 CATCATGCTTACAGTGCTTTGGG - Intergenic
1011025707 6:82867146-82867168 CATGATGAGAACATTGCTGGGGG - Intergenic
1013443096 6:110191280-110191302 CATGAAGCTGATATTGATGTTGG - Intronic
1014238459 6:118988490-118988512 CATTATGCCCACTTTGCTGTAGG + Intronic
1015469212 6:133584640-133584662 CATAATGCCCACAATGCAGTTGG - Intergenic
1017332342 6:153214530-153214552 CCTGCTGCTCTCATTCCTGTAGG - Intergenic
1022348027 7:29537404-29537426 CAAGGTGTTCACATTCCTGTAGG - Intergenic
1022435808 7:30383781-30383803 CCTGATAATGACATTGCTGTTGG - Intronic
1022545615 7:31186045-31186067 CATGAAGCATACATTCCTGTGGG - Intergenic
1023574914 7:41617492-41617514 CATGAAGCTTACATTTCAGTGGG + Intergenic
1024794614 7:53006501-53006523 AATGATGCTCACATTGTGGAGGG + Intergenic
1025274536 7:57565593-57565615 GATGATGTTCACATTTCTTTGGG - Intergenic
1028292227 7:89079577-89079599 TATGAAGCTCACATTCCAGTTGG + Intronic
1029498288 7:100910434-100910456 CAAAATGCTCACATAGCTTTAGG + Intergenic
1029697670 7:102224850-102224872 CATGATGTTGACCTTGCTGTGGG + Intronic
1033274087 7:139957977-139957999 GAGGATGTACACATTGCTGTAGG - Intronic
1035779071 8:2213151-2213173 GATGATGCCCACATTGCGGGGGG - Intergenic
1037739174 8:21591667-21591689 CATGATGCTAACATTAAGGTTGG - Intergenic
1038203564 8:25440860-25440882 CATGCTGCTCTTATAGCTGTTGG - Intronic
1038914290 8:32002911-32002933 CATGTTTCTCACTTTGGTGTAGG - Intronic
1039588475 8:38727278-38727300 CAGGATGCACACTGTGCTGTGGG + Intergenic
1040028021 8:42799484-42799506 CATGTTGCTCAGATTGGTCTTGG + Intergenic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1042379772 8:68100364-68100386 CATGGTGCTCACATTCAAGTGGG + Intronic
1042538186 8:69880423-69880445 GATGATGCCCACTTTGCTGAGGG - Intergenic
1042577212 8:70233593-70233615 CAGTATGCCCAAATTGCTGTAGG - Intronic
1043135211 8:76514579-76514601 CCTGAAGATCACATGGCTGTAGG - Intergenic
1045870852 8:106925250-106925272 CTGGATGCTCACAGTGCTGCTGG + Intergenic
1047498337 8:125424446-125424468 CATGATGCTCAGCTTGATGCTGG - Intergenic
1048810569 8:138281990-138282012 CATGTTGCTTACATTACGGTTGG - Intronic
1048937570 8:139369704-139369726 CATGATGCTCAGAATACAGTAGG - Intergenic
1050012403 9:1198501-1198523 CATGATGATCACATTCTTGGAGG + Intergenic
1053498745 9:38568211-38568233 CAAGAAGCCCACAGTGCTGTAGG + Intronic
1053662444 9:40293094-40293116 CAAGAAGCCCACAGTGCTGTAGG - Intronic
1053912899 9:42923269-42923291 CAAGAAGCCCACAGTGCTGTAGG - Intergenic
1054374574 9:64439319-64439341 CAAGAAGCCCACAGTGCTGTAGG - Intergenic
1054522166 9:66083190-66083212 CAAGAAGCCCACAGTGCTGTAGG + Intergenic
1055115740 9:72603328-72603350 CATGATACTCACATGGTTATGGG - Intronic
1057161801 9:92894509-92894531 CAAGAAGCCCACAGTGCTGTAGG + Intergenic
1057307826 9:93922300-93922322 CCTGAGGCTCAGATTGCTCTGGG - Intergenic
1057678197 9:97152704-97152726 CAAGAAGCCCACAGTGCTGTAGG + Intergenic
1058463861 9:105208955-105208977 TATGATTCACACATTGCCGTCGG - Intergenic
1058597036 9:106626209-106626231 CATGTTGCTCACATTTCAGTGGG + Intergenic
1059293080 9:113245192-113245214 AATTATGGTCACATTTCTGTTGG + Intronic
1061652183 9:132059652-132059674 CATGATGTACAAATGGCTGTGGG - Intronic
1062323095 9:136000085-136000107 CGTGGTTGTCACATTGCTGTGGG - Intergenic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1203690238 Un_GL000214v1:35621-35643 CAGGATGCTCCCATTGTTTTGGG + Intergenic
1203690353 Un_GL000214v1:36392-36414 CAGGATGCTCCCATTGTTTTGGG + Intergenic
1203555369 Un_KI270743v1:202906-202928 CAGGATGCTCCCATTGTTTTGGG - Intergenic
1203555407 Un_KI270743v1:203151-203173 CAGGATGCTCCCATTGTTTTGGG - Intergenic
1203645942 Un_KI270751v1:67799-67821 CAGGATGCTCCCATTGTTTTGGG - Intergenic
1203646037 Un_KI270751v1:68432-68454 CAGGATGCTCCCATTGTTTTGGG - Intergenic
1185759446 X:2678897-2678919 AATGATGCACATATTGTTGTTGG + Intergenic
1187130220 X:16495217-16495239 CATAATGCACACATTACTGATGG + Intergenic
1188283972 X:28305491-28305513 CATGATGTTAACATTGTTCTAGG - Intergenic
1188341663 X:29009546-29009568 GTTGATGATCAGATTGCTGTAGG + Intronic
1195115252 X:101691068-101691090 CATGATGGTGGCATTCCTGTAGG - Intergenic
1196257798 X:113542932-113542954 CATGATCCTCTCATTACTGTAGG + Intergenic