ID: 1168202680

View in Genome Browser
Species Human (GRCh38)
Location 19:54827923-54827945
Sequence GTGGAAATACAGATAGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 208}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168202677_1168202680 -6 Left 1168202677 19:54827906-54827928 CCTACTTCCAATCACCTGTGGAA 0: 1
1: 5
2: 1
3: 15
4: 157
Right 1168202680 19:54827923-54827945 GTGGAAATACAGATAGATCATGG 0: 1
1: 1
2: 2
3: 22
4: 208
1168202673_1168202680 4 Left 1168202673 19:54827896-54827918 CCATCTCACCCCTACTTCCAATC 0: 1
1: 5
2: 5
3: 46
4: 486
Right 1168202680 19:54827923-54827945 GTGGAAATACAGATAGATCATGG 0: 1
1: 1
2: 2
3: 22
4: 208
1168202668_1168202680 14 Left 1168202668 19:54827886-54827908 CCCAAATCCCCCATCTCACCCCT 0: 1
1: 5
2: 3
3: 37
4: 402
Right 1168202680 19:54827923-54827945 GTGGAAATACAGATAGATCATGG 0: 1
1: 1
2: 2
3: 22
4: 208
1168202666_1168202680 20 Left 1168202666 19:54827880-54827902 CCCTCACCCAAATCCCCCATCTC 0: 1
1: 2
2: 2
3: 40
4: 488
Right 1168202680 19:54827923-54827945 GTGGAAATACAGATAGATCATGG 0: 1
1: 1
2: 2
3: 22
4: 208
1168202671_1168202680 6 Left 1168202671 19:54827894-54827916 CCCCATCTCACCCCTACTTCCAA 0: 1
1: 5
2: 4
3: 40
4: 425
Right 1168202680 19:54827923-54827945 GTGGAAATACAGATAGATCATGG 0: 1
1: 1
2: 2
3: 22
4: 208
1168202665_1168202680 21 Left 1168202665 19:54827879-54827901 CCCCTCACCCAAATCCCCCATCT 0: 1
1: 4
2: 2
3: 33
4: 445
Right 1168202680 19:54827923-54827945 GTGGAAATACAGATAGATCATGG 0: 1
1: 1
2: 2
3: 22
4: 208
1168202669_1168202680 13 Left 1168202669 19:54827887-54827909 CCAAATCCCCCATCTCACCCCTA 0: 1
1: 5
2: 1
3: 44
4: 337
Right 1168202680 19:54827923-54827945 GTGGAAATACAGATAGATCATGG 0: 1
1: 1
2: 2
3: 22
4: 208
1168202670_1168202680 7 Left 1168202670 19:54827893-54827915 CCCCCATCTCACCCCTACTTCCA 0: 1
1: 6
2: 2
3: 60
4: 536
Right 1168202680 19:54827923-54827945 GTGGAAATACAGATAGATCATGG 0: 1
1: 1
2: 2
3: 22
4: 208
1168202674_1168202680 -4 Left 1168202674 19:54827904-54827926 CCCCTACTTCCAATCACCTGTGG 0: 6
1: 0
2: 0
3: 14
4: 162
Right 1168202680 19:54827923-54827945 GTGGAAATACAGATAGATCATGG 0: 1
1: 1
2: 2
3: 22
4: 208
1168202672_1168202680 5 Left 1168202672 19:54827895-54827917 CCCATCTCACCCCTACTTCCAAT 0: 1
1: 5
2: 3
3: 30
4: 241
Right 1168202680 19:54827923-54827945 GTGGAAATACAGATAGATCATGG 0: 1
1: 1
2: 2
3: 22
4: 208
1168202676_1168202680 -5 Left 1168202676 19:54827905-54827927 CCCTACTTCCAATCACCTGTGGA No data
Right 1168202680 19:54827923-54827945 GTGGAAATACAGATAGATCATGG 0: 1
1: 1
2: 2
3: 22
4: 208
1168202664_1168202680 22 Left 1168202664 19:54827878-54827900 CCCCCTCACCCAAATCCCCCATC 0: 1
1: 1
2: 7
3: 41
4: 507
Right 1168202680 19:54827923-54827945 GTGGAAATACAGATAGATCATGG 0: 1
1: 1
2: 2
3: 22
4: 208
1168202667_1168202680 19 Left 1168202667 19:54827881-54827903 CCTCACCCAAATCCCCCATCTCA 0: 1
1: 1
2: 3
3: 48
4: 610
Right 1168202680 19:54827923-54827945 GTGGAAATACAGATAGATCATGG 0: 1
1: 1
2: 2
3: 22
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168202680 Original CRISPR GTGGAAATACAGATAGATCA TGG Intronic
900829787 1:4957808-4957830 CTGGAAATACAGTTGCATCATGG + Intergenic
903437259 1:23359896-23359918 GGTGAAATACAGTTAGGTCATGG + Exonic
904339751 1:29827240-29827262 GAGGAAATAGGGATACATCAGGG - Intergenic
905621707 1:39454129-39454151 GTTGAAATACACATTGTTCAAGG - Intronic
907478227 1:54722388-54722410 GTGGCAAACCAGATAGATCAAGG - Intronic
907529060 1:55074894-55074916 GTGGAAATACAGGTAAATGGTGG + Intronic
908988156 1:70051187-70051209 GAGGAAATACAGATAGAGTTGGG + Intronic
910065760 1:83148697-83148719 CTGGAATTGCAGAGAGATCAAGG + Intergenic
910380587 1:86622708-86622730 GAGGAAAAACTAATAGATCATGG + Intergenic
910568060 1:88667548-88667570 GTGGAAAGACAGAAAGAACCTGG - Intergenic
911067674 1:93805786-93805808 GAGGAAATAGAGATAATTCATGG + Intronic
912237978 1:107873445-107873467 GTGAAAATAAAGAAAAATCAAGG + Intronic
913671348 1:121099169-121099191 GGGGAAGTACAGATAGAAAAAGG + Intergenic
914023117 1:143886589-143886611 GGGGAAGTACAGATAGAAAAAGG + Intergenic
914661603 1:149794531-149794553 GGGGAAGTACAGATAGAAAAAGG + Intronic
914784034 1:150812035-150812057 GGGGAAACATAGTTAGATCAGGG + Exonic
917116286 1:171607135-171607157 GTGGAAAAACAGACATATGAAGG - Intergenic
918589971 1:186230175-186230197 GAGGAAATACAGCTATACCAGGG - Intergenic
921772306 1:219055325-219055347 GTAAAAATACATAGAGATCATGG + Intergenic
923293776 1:232573157-232573179 ATGGAAATAATGATTGATCAAGG + Intergenic
923897842 1:238293166-238293188 GTGGAATTTCAGATAGCACAGGG - Intergenic
924169472 1:241322749-241322771 TTGGAAATACTTTTAGATCATGG + Intronic
1063657156 10:8002533-8002555 GAGGAACTACTGATAGAGCAGGG + Intronic
1066162637 10:32750584-32750606 GAGGAAATACAATGAGATCAAGG - Intronic
1068344074 10:55747975-55747997 ATGGAAAAACAGATAGGGCACGG - Intergenic
1070266930 10:74912318-74912340 ATGGATAGACAGATAGATGAAGG + Intronic
1073838633 10:107472674-107472696 ATGTAAATACAGATAATTCAAGG - Intergenic
1074440125 10:113470848-113470870 GGGGAAATACAGAAGGGTCATGG + Intergenic
1075681427 10:124335607-124335629 GTGGAGATACAGGGAGAGCATGG + Intergenic
1078044700 11:7903145-7903167 CTGGAAAAACAGATAGCTAAGGG - Intergenic
1079361609 11:19775004-19775026 GTGAAAATACTGCAAGATCAGGG - Intronic
1079810095 11:24987736-24987758 CTGGAAGTTTAGATAGATCAAGG + Intronic
1085871355 11:80353721-80353743 GTGGAAATACAGTGAATTCAGGG + Intergenic
1086143695 11:83526962-83526984 GTGTAAAGACAAATAAATCATGG - Intronic
1086743366 11:90395593-90395615 TTGTAAATTCAGAGAGATCATGG + Intergenic
1087347496 11:96990342-96990364 GTGAAAAAACAGATGGATCAGGG + Intergenic
1087789776 11:102393672-102393694 GTGGACATGCAGAGAGATCTTGG + Intergenic
1088494360 11:110418658-110418680 GGGGAAATTCAGAGAGATCAGGG - Intergenic
1091158150 11:133393265-133393287 ATGGAAATACACATAAAACAAGG + Intronic
1092008154 12:5087004-5087026 GAGTAATTCCAGATAGATCAAGG + Intergenic
1093288156 12:17291587-17291609 GTGGAAACACAGAGTAATCATGG - Intergenic
1096867336 12:54572565-54572587 GGGGAAATGGAGATATATCAAGG - Intronic
1097465009 12:59911504-59911526 GTGAAAATACAGATATGTTAAGG - Intergenic
1098390032 12:69960097-69960119 GAGTAAATACACATATATCAAGG + Intergenic
1098451428 12:70622432-70622454 CTGGAATTACAGACACATCATGG - Exonic
1098892784 12:76026776-76026798 GTGGAAATCCATTTAGATCTGGG - Exonic
1100068556 12:90681762-90681784 ATAGAAATATAGATAGATAAAGG + Intergenic
1100672084 12:96824533-96824555 TTGGAAATACAGATAAATAAGGG + Intronic
1103644128 12:122377306-122377328 GTTGAAATACACACACATCAGGG - Intronic
1104048261 12:125178735-125178757 GTGGAATTACAGAAATGTCATGG - Intergenic
1105045163 12:132997077-132997099 GTTGAAGTACAGTTACATCAAGG + Intronic
1105438515 13:20397117-20397139 GTGGACATGCAGAAAGATCTTGG + Intergenic
1105503797 13:20993069-20993091 GTGGAGATACAGAAAGACCCCGG + Intronic
1107042627 13:35965972-35965994 GAGGAAAAACAGAAAGCTCAAGG + Intronic
1107866481 13:44708084-44708106 ATAAATATACAGATAGATCAGGG - Intergenic
1109384090 13:61604642-61604664 GTGGGAACACAGATAGAAGATGG + Intergenic
1109627162 13:64990985-64991007 GTGGAAATACAGACAGATAAAGG - Intergenic
1110078771 13:71285255-71285277 GAGAAAATAGAGAGAGATCAGGG - Intergenic
1110536565 13:76657665-76657687 AAGTACATACAGATAGATCATGG - Intergenic
1111425299 13:88072199-88072221 GTGGAATTCTAGATAAATCAGGG + Intergenic
1116139330 14:40970398-40970420 TTGGAAATACGGATAAATAAAGG - Intergenic
1119207686 14:72806884-72806906 GTTGAAATGCAGCAAGATCAGGG + Intronic
1120512523 14:85432941-85432963 GTGCAAATACATATACACCATGG + Intergenic
1122794171 14:104197497-104197519 GTGGATATATGGATAGATGATGG - Intergenic
1123485617 15:20735069-20735091 GGGGAAATAAAGATATATCCAGG - Intergenic
1123542102 15:21304120-21304142 GGGGAAATAAAGATATATCCAGG - Intergenic
1124634346 15:31355437-31355459 GTGGTAATACACATAGCTTAAGG + Intronic
1124686140 15:31783714-31783736 ATGGAAATACAGCTAGTTCAGGG - Intronic
1125118571 15:36124918-36124940 ATGGAAATACATATAGAATATGG - Intergenic
1125817872 15:42601632-42601654 GTAGAAAAACAGATATATCCGGG - Intronic
1128836290 15:70811501-70811523 GTGGAAACACAGATACATTTGGG - Intergenic
1202950420 15_KI270727v1_random:31260-31282 GGGGAAATAAAGATATATCCAGG - Intergenic
1133636552 16:7671776-7671798 GTGGATATACTGATAGATACAGG - Intronic
1138126033 16:54439328-54439350 GGGGTGATAGAGATAGATCATGG + Intergenic
1140206349 16:72936879-72936901 GTTGAAATACAGAGAGACGATGG + Intronic
1140997485 16:80275379-80275401 CTGGAAATATTGATATATCAGGG + Intergenic
1144463247 17:15475380-15475402 GTGGATATCTAGATAGATGATGG + Intronic
1144532410 17:16052140-16052162 CTGGAACTACAGATAGATGCCGG + Intronic
1144633762 17:16890136-16890158 TTGGCAATTCAGAAAGATCAAGG + Intergenic
1149980395 17:61306260-61306282 GAAGAAATACAAATAGCTCATGG - Intronic
1154046526 18:10910961-10910983 GTGGAAATAAAGATAGAATGGGG - Intronic
1156787158 18:40929297-40929319 GTGGACAGACACATAGATAATGG + Intergenic
1157616431 18:48990327-48990349 GTGGAAATGGAGAGAAATCAGGG - Intergenic
1161726488 19:5932324-5932346 CCAGAAATACAGAGAGATCAGGG - Intronic
1161865006 19:6827114-6827136 GTGGAAACACAGACAGGGCAGGG + Intronic
1162595201 19:11623269-11623291 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1164073505 19:21791387-21791409 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1165076942 19:33284800-33284822 TTGGAAAGACAGAAAGATGAAGG - Intergenic
1165279561 19:34784691-34784713 GTGGAATTACAGTAAGATCTGGG - Intergenic
1167808630 19:51809015-51809037 CTGGAAAAACAGATAGAAAAGGG - Intronic
1167882849 19:52476477-52476499 CTGGAAAAACAGATAGAAAAGGG - Intronic
1168190339 19:54733823-54733845 ATGGAGATACAGATAGATCATGG + Intronic
1168194627 19:54765038-54765060 GTGGAGATTCAGATAGACCATGG + Intronic
1168196881 19:54781485-54781507 GTGGAGATTCAGATAGACCATGG + Intronic
1168202680 19:54827923-54827945 GTGGAAATACAGATAGATCATGG + Intronic
1168205248 19:54845744-54845766 GTGGAGATTCAGATAGACCATGG + Intronic
1168207483 19:54861953-54861975 GTGGAGATACAGATAGATCATGG + Intronic
925249896 2:2423143-2423165 ATGGAAATACAGATTGATGCAGG + Intergenic
925633286 2:5916646-5916668 GAGGAAAATCAGAGAGATCAAGG + Intergenic
926551286 2:14304259-14304281 TTGAAACTACAGATAGACCATGG - Intergenic
926848069 2:17163919-17163941 GGGGAAGTAGAGTTAGATCAGGG - Intergenic
927449139 2:23191435-23191457 GTAGAAATCCAGATTGACCAGGG + Intergenic
928650464 2:33398643-33398665 CTGGAAATACAGAAACAGCATGG + Exonic
928740661 2:34348261-34348283 TTTGAAATTCAGATAGATTATGG + Intergenic
931599081 2:63984424-63984446 GAGGAAAGACAGATACATAAAGG - Intronic
931911058 2:66900909-66900931 TTGGAAATACAGATATAGTATGG - Intergenic
934245407 2:90301247-90301269 GTGGAAATAGAAATAAAGCATGG - Intergenic
934263338 2:91495782-91495804 GTGGAAATAGAAATAAAGCATGG + Intergenic
935824723 2:106934102-106934124 GTGGAAATACAGATGGACCTTGG - Intergenic
938929486 2:136074194-136074216 CTGGAAAAACAGATAGAAAAGGG - Intergenic
939082724 2:137682593-137682615 TTGGAACGACAGATAGAACATGG + Intergenic
939401178 2:141695963-141695985 GTAGAAATACAGGTAGTTCAAGG - Intronic
941074408 2:160990697-160990719 GGTGAACTCCAGATAGATCAAGG - Intergenic
941172982 2:162162497-162162519 GTGGAACTACAGATGGGGCAGGG - Intergenic
943245218 2:185439017-185439039 GTGGAAATATAGTTAGTTCATGG + Intergenic
943862145 2:192880994-192881016 TTGGAAAGAAAGATAGATCATGG - Intergenic
945521820 2:210836882-210836904 GAGTAAATACAGTTATATCATGG + Intergenic
946156320 2:217809104-217809126 ATGGAGATACAGATGGATGAAGG + Intronic
946282360 2:218675374-218675396 GTGGGAATGCAGATAGTACAGGG - Exonic
947316476 2:228864765-228864787 GTGGCAATACCGTTATATCATGG - Intronic
947453838 2:230234862-230234884 GCGGAAATACAGATGTTTCAGGG - Intronic
948003710 2:234590211-234590233 GTGGGCAGACAGATAGTTCATGG + Intergenic
948165614 2:235859569-235859591 ATGGAAATACAGTTAGAAAAGGG - Intronic
948743158 2:240061942-240061964 GTGGAAAGGTAGATGGATCATGG - Intergenic
1168917883 20:1506249-1506271 GTGGAAAGAAATATAGACCAGGG + Intergenic
1169176442 20:3519703-3519725 GTGGAGATACAGATAGTTTCTGG - Intronic
1170920699 20:20677007-20677029 GTGGGGATTCAGTTAGATCAGGG - Intronic
1173333223 20:42092902-42092924 GTGGAAAGCCTGAGAGATCAGGG - Intronic
1173558839 20:43987532-43987554 GTGTAAAAAAAGAAAGATCAAGG + Intronic
1173658353 20:44716348-44716370 GTGAAAATACAGTGAGATCGTGG - Intronic
1174372456 20:50101246-50101268 GTTGCAATACAGATAGATATTGG - Intronic
1177613937 21:23491932-23491954 GTGGAAAGACAAACAGATAATGG + Intergenic
1182385033 22:29931169-29931191 GTGGAAATACTGACACAACAAGG + Intronic
1184003850 22:41694655-41694677 GTGGAAATTCAGATGGAAGAGGG + Exonic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
950623603 3:14227512-14227534 CTGGAAAAACAGATAGAAAAGGG + Intergenic
951139060 3:19140143-19140165 GTGAAAGATCAGATAGATCAAGG + Intergenic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
954510760 3:51122830-51122852 GAGGACATAGAGATAGATTAGGG + Intronic
954846558 3:53563755-53563777 GTCAAAGTATAGATAGATCATGG - Intronic
956612079 3:71134469-71134491 GTAGATAGACAGATAGCTCAAGG + Intronic
957464382 3:80567537-80567559 GTGGAAATACAGAAACATCTGGG + Intergenic
957621636 3:82600902-82600924 GTTGAAACACAGATAGAAGAGGG - Intergenic
958551052 3:95613226-95613248 GTGGAAAAACAGATGAATAAAGG + Intergenic
958610443 3:96417243-96417265 GTGAAAATTTAGAGAGATCATGG + Intergenic
960498738 3:118409169-118409191 GTTGAAATAAAGATACATCATGG - Intergenic
961224084 3:125223491-125223513 GAGGCTACACAGATAGATCAAGG + Intergenic
963082249 3:141404741-141404763 GTGAAAATAGAGACAGGTCATGG + Intronic
963220649 3:142807944-142807966 GTGAAACTGCAGATAGATAAAGG - Intergenic
963831822 3:150016701-150016723 GTGGTTCTGCAGATAGATCAAGG + Intronic
964984270 3:162719704-162719726 GTGAAAATACAGCTAGAGGATGG + Intergenic
965733014 3:171792422-171792444 CTGGGAATGCAGATGGATCAGGG + Intronic
967409898 3:189156724-189156746 GAGGAAATACTGATAGATAGAGG - Intronic
967546553 3:190736896-190736918 CTGCAAATTCAGATGGATCATGG - Intergenic
968277657 3:197453011-197453033 GTGGAAATTCAGAGAAATCAAGG + Intergenic
968406452 4:343759-343781 CTGAAAATACAAATATATCAAGG - Intronic
969182543 4:5453397-5453419 GTGGCAATGCAGAAAGACCAGGG + Intronic
969189028 4:5502062-5502084 GTGGAAATTCAGGTGCATCAGGG + Intergenic
969568635 4:7995200-7995222 GTGGAAAGACAGACAGTTTAGGG - Intronic
974178564 4:58357348-58357370 ATGGTAATAAAGATAAATCAAGG - Intergenic
974459099 4:62164636-62164658 GTGGAAGGGCAAATAGATCAAGG - Intergenic
976863046 4:89689531-89689553 ATGGAAATGCATATAGATAATGG + Intergenic
977073344 4:92421368-92421390 GAGGAAATACAGATGGAAAAAGG + Intronic
977870451 4:102083976-102083998 GTGAAAACACAGGCAGATCATGG + Intergenic
983514344 4:168640828-168640850 GCTGAAATACAGAAAGTTCAAGG - Intronic
983890719 4:173026963-173026985 ATAGATATACAGATATATCAGGG - Intronic
983996656 4:174190430-174190452 GTGAAAATACAAATTCATCAAGG + Intergenic
984450315 4:179892388-179892410 ATGGAAATACAGCTAGAAAATGG + Intergenic
985238371 4:187901846-187901868 GTGGATATACAGATAGCACAAGG + Intergenic
987339561 5:16927743-16927765 GTTGAAATACAGCTAGAACAAGG - Intronic
995488964 5:112669831-112669853 GAGGAAATACAGACAAAGCAAGG - Intergenic
996298029 5:121947014-121947036 ATGGACATAAACATAGATCAGGG + Intergenic
999747048 5:154600533-154600555 GTGGAGATAAAAATAGGTCATGG - Intergenic
1001817382 5:174681310-174681332 TTGTAAATACAGAAAGCTCAGGG + Intergenic
1002372912 5:178769031-178769053 GAGGAAACACAGAGAGATGAGGG - Intergenic
1002514820 5:179749855-179749877 GTGGAAATACAGTCAGAGCAAGG - Intronic
1003721923 6:8713107-8713129 GGGGAAATAGGGATGGATCAAGG + Intergenic
1003845629 6:10171315-10171337 TTGGAAATGCAGAGAGAACAAGG + Intronic
1006228787 6:32564302-32564324 CTGGAAAAACAGATAGAAAAGGG - Intronic
1007776612 6:44227558-44227580 GTGGAAACACAGACAGGCCAGGG - Intronic
1008320001 6:50099815-50099837 ATGGAAATTCAGATAAATCTTGG + Intergenic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1009695057 6:67091887-67091909 GTGGGAATAATGATAAATCACGG + Intergenic
1010257916 6:73780732-73780754 ATGGAAATACATATACATAAAGG - Intronic
1011072498 6:83401073-83401095 GGGGAAATAAAGGTAGAGCAGGG - Intronic
1012167710 6:95979251-95979273 GTGGGAGTACAGATATATCTTGG + Intergenic
1013970443 6:116011806-116011828 GTGGAAACACAGGTAGATGCAGG - Intronic
1015048740 6:128813134-128813156 ATGGTAATAAAGATTGATCATGG - Intergenic
1015711817 6:136149928-136149950 GTGGAAAGAAAACTAGATCATGG + Intronic
1016377732 6:143440820-143440842 GTAGAATTACACAGAGATCAAGG + Intronic
1021212297 7:17869635-17869657 TTGGAAATACTGATTCATCATGG - Intronic
1028285664 7:88995215-88995237 GTAGAAAAATAGATAGGTCAAGG + Intronic
1030447362 7:109663954-109663976 CTGGATATACAGATAGATTCTGG + Intergenic
1032685203 7:134225539-134225561 GTGGAAATACAAATGTAACAAGG + Intronic
1033877489 7:145841021-145841043 GGGGATAGAGAGATAGATCAGGG - Intergenic
1036767112 8:11556195-11556217 GTGGAGATACAGATAGTTTAAGG + Intronic
1038683683 8:29695062-29695084 GAGGTAAAACTGATAGATCATGG - Intergenic
1040345447 8:46488492-46488514 TTGGAAAAACAGATAGAAAAGGG - Intergenic
1044585492 8:93865723-93865745 TTTGAAATGCAGATAGTTCAAGG + Intronic
1045172228 8:99684462-99684484 GTGGAGATAGAGAGAGTTCAAGG - Intronic
1045485021 8:102624116-102624138 GTAGAAATATATATATATCAGGG + Intergenic
1045495523 8:102704880-102704902 TTTGAAATTCAGATTGATCAGGG + Intergenic
1050011333 9:1188466-1188488 GTGGAAAGAGAGAAAGAGCATGG + Intergenic
1050592577 9:7175258-7175280 AGGGAAATACAGATAGCACACGG - Intergenic
1051450079 9:17187061-17187083 CTGAAAATGCAGGTAGATCAGGG - Intronic
1051577295 9:18631307-18631329 GTGCAATTACAGATAAACCAGGG + Intronic
1052386441 9:27828829-27828851 GTGGAAATACAAAGAGGTCAAGG - Intergenic
1052479358 9:29003045-29003067 GTGAAAATACGGATAGAAAATGG + Intergenic
1052540080 9:29799768-29799790 CTGGAAACACAGCAAGATCATGG + Intergenic
1053010172 9:34628392-34628414 GTGAAAATAGAGATGGAACAGGG + Intergenic
1053547001 9:39033881-39033903 GTGGAAATTCAGCTATGTCATGG - Intergenic
1053811319 9:41855541-41855563 GTGGAAATTCAGCTATGTCATGG - Intergenic
1054619275 9:67331898-67331920 GTGGAAATTCAGCTATGTCATGG + Intergenic
1056300686 9:85237425-85237447 GTGGAAATACTGGCAGATCAGGG + Intergenic
1056987832 9:91380535-91380557 TTTGAAATACAGATAGTTTAAGG - Intergenic
1060632370 9:125171024-125171046 GTGAAAACACACATGGATCATGG + Intronic
1062329808 9:136034089-136034111 AGGGAAAAACAGAGAGATCAAGG + Intronic
1185481875 X:452319-452341 GTGGATAAATAGATAGATAATGG - Intergenic
1185811804 X:3117288-3117310 ATTGAAGTACAGATAGATTAGGG - Intergenic
1188012342 X:25070777-25070799 GTTGCAATACCCATAGATCACGG + Intergenic
1188161059 X:26803546-26803568 GTGGAAATGTAAATATATCAGGG + Intergenic
1188745824 X:33841944-33841966 GTGGAGATACAGATAGCACAGGG - Intergenic
1188968236 X:36580851-36580873 GAGGAAATATACATAAATCAAGG + Intergenic
1189067664 X:37828209-37828231 GAGGAAATAAAGAAATATCAGGG - Intronic
1190122718 X:47675652-47675674 GTGAAAATACAGATACTGCATGG - Intergenic
1190996301 X:55613267-55613289 GTGGATATATATATATATCAGGG + Intergenic
1192761997 X:74103855-74103877 ATGGACATAGACATAGATCATGG + Intergenic
1193413271 X:81190917-81190939 GTGAAAGAACAAATAGATCAAGG - Intronic
1200526918 Y:4285064-4285086 GTGGAATCACAGATAGTACATGG - Intergenic
1200993082 Y:9360874-9360896 GTGGAAGCAGAGATAGTTCAAGG + Intronic
1200995736 Y:9381144-9381166 GTGGAAGCAGAGATAGTTCAAGG + Intergenic
1200998401 Y:9401496-9401518 GTGGAAGCAGAGATAGTTCAAGG + Intergenic
1201000909 Y:9470026-9470048 GTGGAAGCAGAGATAGTTCAAGG + Intronic
1201008891 Y:9530945-9530967 GTGGAAGCAGAGATAGTTCAAGG + Intergenic