ID: 1168210844

View in Genome Browser
Species Human (GRCh38)
Location 19:54888918-54888940
Sequence TCACGCCACCACGCCCGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1207
Summary {0: 1, 1: 0, 2: 7, 3: 91, 4: 1108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168210844_1168210848 3 Left 1168210844 19:54888918-54888940 CCTGGCCGGGCGTGGTGGCGTGA 0: 1
1: 0
2: 7
3: 91
4: 1108
Right 1168210848 19:54888944-54888966 TGTCGTCCCAGCTACTCAGGAGG 0: 176
1: 46608
2: 165657
3: 224418
4: 206946
1168210844_1168210850 9 Left 1168210844 19:54888918-54888940 CCTGGCCGGGCGTGGTGGCGTGA 0: 1
1: 0
2: 7
3: 91
4: 1108
Right 1168210850 19:54888950-54888972 CCCAGCTACTCAGGAGGCTGAGG 0: 92886
1: 198857
2: 236674
3: 157910
4: 88870
1168210844_1168210852 13 Left 1168210844 19:54888918-54888940 CCTGGCCGGGCGTGGTGGCGTGA 0: 1
1: 0
2: 7
3: 91
4: 1108
Right 1168210852 19:54888954-54888976 GCTACTCAGGAGGCTGAGGCAGG 0: 77881
1: 176222
2: 210480
3: 146546
4: 90715
1168210844_1168210846 0 Left 1168210844 19:54888918-54888940 CCTGGCCGGGCGTGGTGGCGTGA 0: 1
1: 0
2: 7
3: 91
4: 1108
Right 1168210846 19:54888941-54888963 GCCTGTCGTCCCAGCTACTCAGG 0: 262
1: 77889
2: 200439
3: 240585
4: 175775

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168210844 Original CRISPR TCACGCCACCACGCCCGGCC AGG (reversed) Intronic
900011987 1:121546-121568 GTGAGCCACCACGCCCGGCCAGG + Intergenic
900042047 1:477559-477581 GTGAGCCACCACGCCCGGCCAGG + Intergenic
900063485 1:712505-712527 GTGAGCCACCACGCCCGGCCAGG + Intergenic
900140674 1:1138237-1138259 TCAAGCCACTGTGCCCGGCCTGG + Intergenic
901095348 1:6674514-6674536 TCACGCCACTACACTCAGCCTGG + Intronic
901229798 1:7635323-7635345 GTGAGCCACCACGCCCGGCCCGG - Intronic
901391699 1:8950264-8950286 ACGAGCCACCATGCCCGGCCTGG + Intronic
901423615 1:9167028-9167050 ATGAGCCACCACGCCCGGCCTGG - Intergenic
901496152 1:9623276-9623298 TTGAGCCACCGCGCCCGGCCTGG - Intergenic
901520676 1:9782722-9782744 GTGAGCCACCACGCCCGGCCCGG - Intronic
901630650 1:10646673-10646695 TCACGGCACCCCGCCAGGGCTGG - Intronic
901697586 1:11020624-11020646 ATGAGCCACCACGCCCGGCCGGG - Intronic
901811603 1:11769940-11769962 GCCAGCCACCACGCCTGGCCAGG + Intronic
901838297 1:11938231-11938253 CTGAGCCACCACGCCCGGCCAGG + Intronic
902061296 1:13645412-13645434 GTGAGCCACCACGCCCGGCCTGG + Intergenic
902272647 1:15315766-15315788 GCAAGCCACCGCGCCCAGCCGGG + Intronic
902322017 1:15674574-15674596 ATGAGCCACCACGCCCGGCCAGG + Intergenic
902346512 1:15822134-15822156 GTGAGCCACCACGCCCGGCCCGG - Intergenic
902423110 1:16297577-16297599 GTGAGCCACCACGCCCGGCCTGG - Intronic
902859113 1:19231977-19231999 GTGAGCCACCACGCCCGGCCAGG - Intronic
902861946 1:19252796-19252818 GCACGCCACCACACCCAGCTAGG + Intronic
902907395 1:19568480-19568502 CTGAGCCACCACGCCCGGCCTGG + Intergenic
902993648 1:20207014-20207036 TTAAGCCACCGTGCCCGGCCTGG + Intergenic
903053790 1:20620853-20620875 GCGAGCCACCACGCCCGGCCTGG + Intergenic
903056004 1:20636622-20636644 ATGAGCCACCACGCCCGGCCTGG + Intronic
903123590 1:21232959-21232981 GTGAGCCACCACGCCCGGCCAGG + Intronic
903144038 1:21358456-21358478 GTGAGCCACCACGCCCGGCCCGG - Intergenic
903150116 1:21401546-21401568 GTGAGCCACCACGCCCGGCCTGG - Intergenic
903253774 1:22077006-22077028 GCATGCCACCATGCCCGGCTGGG - Intronic
903852973 1:26319310-26319332 GCCCGCCACCACGCCACGCCCGG - Intronic
903885858 1:26540721-26540743 GCACGCCACTATGCCCAGCCAGG + Intronic
903907810 1:26697839-26697861 TCACCCCCTCACCCCCGGCCAGG - Intronic
904053608 1:27655945-27655967 CCACCCCACCCCCCCCGGCCAGG - Intergenic
904124885 1:28231431-28231453 TTGAGCCACCACGCCTGGCCGGG - Intronic
904127647 1:28252878-28252900 GTGAGCCACCACGCCCGGCCAGG + Intergenic
904371865 1:30052865-30052887 GCAAGTCACCACACCCGGCCAGG + Intergenic
904411114 1:30325470-30325492 TCACCCCACCCCACCCAGCCAGG + Intergenic
904665755 1:32120016-32120038 GTGAGCCACCACGCCCGGCCTGG + Intronic
904692782 1:32306961-32306983 ATGAGCCACCACGCCCGGCCAGG - Intronic
904754859 1:32762868-32762890 ATGGGCCACCACGCCCGGCCCGG + Intronic
905054324 1:35079827-35079849 TTGAGGCACCACGCCCGGCCAGG - Intronic
905070150 1:35218326-35218348 ATGAGCCACCACGCCCGGCCAGG + Intergenic
905302248 1:36993408-36993430 ACACGCCACCCCACCCCGCCTGG + Intronic
905420907 1:37843281-37843303 TTAAGCCACCACGCCTGGCCTGG + Intronic
905622942 1:39464623-39464645 GTGAGCCACCACGCCCGGCCAGG - Intronic
905623210 1:39467082-39467104 ATAAGCCACCACGCCCGGCCAGG - Intronic
905764100 1:40585932-40585954 ATGAGCCACCACGCCCGGCCAGG - Intergenic
905818405 1:40969998-40970020 GTGAGCCACCACGCCCGGCCCGG + Intergenic
906131667 1:43462612-43462634 GTGAGCCACCACGCCCGGCCAGG + Intergenic
906286192 1:44589330-44589352 GTGAGCCACCACGCCCGGCCAGG - Intronic
906388919 1:45396769-45396791 ATGAGCCACCACGCCCGGCCTGG + Intronic
906418234 1:45639731-45639753 GCCCGCCACCACACCCGGCTCGG - Intronic
906473095 1:46147385-46147407 GTGAGCCACCACGCCCGGCCAGG + Intronic
906500709 1:46340342-46340364 GTGAGCCACCACGCCCGGCCAGG + Exonic
906817442 1:48893397-48893419 ATGAGCCACCACGCCCGGCCTGG - Intronic
906819158 1:48911333-48911355 ATGAGCCACCACGCCCGGCCAGG - Intronic
907093134 1:51748069-51748091 TCAAGCCACCGTGCCCAGCCAGG + Intronic
907375373 1:54033833-54033855 TTGAGCCACCACGCCCAGCCAGG - Intronic
907409875 1:54276328-54276350 CTGAGCCACCACGCCCGGCCAGG - Intronic
908643861 1:66255368-66255390 ATAAGCCACCACGCCCAGCCTGG + Intronic
909128372 1:71705570-71705592 GCCCACCACCACGCCAGGCCTGG - Intronic
909135452 1:71793389-71793411 ATGAGCCACCACGCCCGGCCTGG + Intronic
910691910 1:89974004-89974026 ACAGGCCACCGCGCCCGGCCGGG - Intergenic
911135353 1:94433434-94433456 GTGAGCCACCACGCCCGGCCCGG + Intronic
911430928 1:97785973-97785995 TTGAGCCACCACGTCCGGCCGGG + Intronic
911931030 1:103903712-103903734 GCCAGCCACTACGCCCGGCCAGG + Intergenic
911986637 1:104634668-104634690 GAGAGCCACCACGCCCGGCCTGG - Intergenic
912041892 1:105400740-105400762 TCATGCCACCACGCCCGGCTAGG + Intergenic
912642556 1:111361279-111361301 GTGAGCCACCACGCCCGGCCTGG + Intergenic
912823330 1:112884569-112884591 GTGAGCCACCACGCCCGGCCAGG - Intergenic
912964830 1:114228404-114228426 ATAAGCCACCACGCCTGGCCAGG - Intergenic
913184181 1:116353198-116353220 ACAGGCCACTATGCCCGGCCTGG + Intergenic
914387341 1:147182915-147182937 GTGAGCCACCACGCCCGGCCTGG - Intronic
914675102 1:149902270-149902292 GTGAGCCACCACGCCCGGCCCGG + Intergenic
914688352 1:150002966-150002988 GAGAGCCACCACGCCCGGCCTGG - Intronic
914810083 1:151021170-151021192 GTGAGCCACCACGCCCGGCCTGG - Intronic
914810235 1:151022390-151022412 GTGAGCCACCACGCCCGGCCTGG + Intronic
914839410 1:151235838-151235860 GTGAGCCACCACGCCCGGCCTGG - Intronic
914884042 1:151570560-151570582 ACGAGCCACCATGCCCGGCCTGG + Intronic
914896260 1:151676586-151676608 GTGAGCCACCACGCCCGGCCAGG + Intronic
915347345 1:155204305-155204327 GTAAGCCACCGCGCCCGGCCTGG - Intronic
915347767 1:155206692-155206714 GCCCGCCACCACGCCCGGCTAGG - Intronic
915615978 1:157038744-157038766 GCAAGCCACCACGCCAGGCCTGG - Intronic
915741532 1:158122316-158122338 GTAAGCCACCACGCCTGGCCTGG - Intergenic
916031332 1:160880021-160880043 GTGAGCCACCACGCCCGGCCAGG - Intronic
917369096 1:174269232-174269254 CTGCGCCACCGCGCCCGGCCAGG + Intronic
917376378 1:174352088-174352110 GTGAGCCACCACGCCCGGCCGGG + Intronic
917874933 1:179277740-179277762 ACGAGCCACCACGCCCGGCCAGG - Intergenic
917966293 1:180180795-180180817 GTGAGCCACCACGCCCGGCCTGG + Intronic
918213582 1:182373702-182373724 TACAGCCACCATGCCCGGCCTGG - Intergenic
918629493 1:186699263-186699285 GTAAGCCACCGCGCCCGGCCGGG - Intergenic
918874268 1:190019414-190019436 TCCCGCCACCACCCCAGGCTAGG - Intergenic
919308094 1:195870154-195870176 GCCCGCCACCACGCCCAGCTAGG - Intergenic
919695773 1:200573582-200573604 GCCCGCCACCGCGCCCGGCAAGG + Intronic
919888689 1:201954410-201954432 ACGTGTCACCACGCCCGGCCTGG + Intergenic
920129041 1:203716916-203716938 ACGAGCCACTACGCCCGGCCGGG - Intronic
920219926 1:204389477-204389499 GTGAGCCACCACGCCCGGCCAGG + Intergenic
920273559 1:204786328-204786350 ACAAACCACCACGCCCAGCCAGG - Intergenic
920802498 1:209202516-209202538 TTGAGCCACCGCGCCCGGCCAGG - Intergenic
921401974 1:214734592-214734614 GTGAGCCACCACGCCCGGCCAGG + Intergenic
921476327 1:215615336-215615358 GTGAGCCACCACGCCCGGCCGGG - Intronic
922159828 1:223071236-223071258 ATAAGCCACCATGCCCGGCCTGG - Intergenic
922232227 1:223697168-223697190 ACAAGCCACCACGCATGGCCAGG - Intergenic
922289992 1:224202088-224202110 ATGAGCCACCACGCCCGGCCTGG - Intergenic
922411310 1:225378597-225378619 TGAGCCCACCGCGCCCGGCCAGG - Intronic
922632505 1:227130808-227130830 TCATGCCACTACACCCAGCCTGG + Intronic
922733259 1:227964903-227964925 TTGAGCCACCACGCCCAGCCAGG - Intergenic
923481198 1:234385778-234385800 ATGAGCCACCACGCCCGGCCAGG + Intergenic
923611088 1:235494602-235494624 ACACACCACCACGCCTGGCTAGG + Intronic
923666288 1:236001385-236001407 TTGAGCCACCACGCCCAGCCTGG + Intronic
924055329 1:240119045-240119067 GTGAGCCACCACGCCCGGCCAGG - Intronic
924111194 1:240701484-240701506 TTGAGCCACCATGCCCGGCCTGG + Intergenic
924174664 1:241378344-241378366 GTGAGCCACCACGCCCGGCCTGG + Intergenic
924341589 1:243040215-243040237 GTGAGCCACCACGCCCGGCCAGG + Intergenic
924498431 1:244612805-244612827 GCGCGGCACCACGCCCGGCCAGG + Intronic
924523913 1:244829503-244829525 GTAAGCCACCGCGCCCGGCCTGG + Intergenic
924530503 1:244889781-244889803 GCGAGCCACCACGCCTGGCCAGG + Intergenic
1063584819 10:7342677-7342699 GTGAGCCACCACGCCCGGCCTGG + Intronic
1064047701 10:12032847-12032869 TCGTGCCACCACCCCTGGCCAGG - Intronic
1064362320 10:14677337-14677359 TTGAGCCACCGCGCCCGGCCAGG - Intronic
1064379080 10:14824321-14824343 GTAAGCCACCATGCCCGGCCAGG - Intronic
1064417388 10:15161640-15161662 GCGAGCCACCACGCCTGGCCGGG + Intronic
1064747516 10:18492336-18492358 GTGAGCCACCACGCCCGGCCAGG - Intronic
1064797934 10:19035096-19035118 GTGAGCCACCACGCCCGGCCAGG - Intergenic
1064834741 10:19513455-19513477 GTGAGCCACCACGCCCGGCCAGG - Intronic
1065010932 10:21420043-21420065 GCGCTCCACCACACCCGGCCGGG - Intergenic
1065379583 10:25076341-25076363 GCATGCTACCACACCCGGCCTGG + Intergenic
1065588074 10:27240028-27240050 TTGAGCCACCGCGCCCGGCCCGG + Intronic
1065756113 10:28932681-28932703 GTGAGCCACCACGCCCGGCCAGG + Intergenic
1067137309 10:43622256-43622278 TTGAGCCACCACGCCTGGCCAGG - Intergenic
1067248360 10:44565611-44565633 TCTCCCCACCACACCTGGCCTGG - Intergenic
1067396329 10:45922901-45922923 GTGAGCCACCACGCCCGGCCAGG - Intergenic
1067864650 10:49892006-49892028 GTGAGCCACCACGCCCGGCCAGG - Intronic
1067970646 10:50966380-50966402 GCGAGCCACCGCGCCCGGCCAGG + Intergenic
1068104872 10:52602203-52602225 GTAAGCCACCGCGCCCGGCCCGG - Intergenic
1069017457 10:63446156-63446178 TTGAGCCACCACGCCCCGCCTGG + Intronic
1069412846 10:68170864-68170886 TTGAGCCACCATGCCCGGCCGGG - Intronic
1069627533 10:69877397-69877419 TCCCTCCACCTTGCCCGGCCAGG + Intronic
1069816720 10:71201000-71201022 GTGAGCCACCACGCCCGGCCTGG - Intergenic
1069837008 10:71315602-71315624 GCAAGCCACTGCGCCCGGCCAGG + Intergenic
1069923607 10:71832751-71832773 GTGAGCCACCACGCCCGGCCCGG - Intronic
1069934613 10:71906552-71906574 ATGAGCCACCACGCCCGGCCAGG - Intergenic
1070001080 10:72377965-72377987 GTAAGCCACCACGCCTGGCCTGG - Intronic
1070044670 10:72820792-72820814 GTGAGCCACCACGCCCGGCCTGG + Intronic
1070128806 10:73642486-73642508 TCTAGCCACCACGCCCAGCCAGG + Intergenic
1070257595 10:74825412-74825434 GCCCGCCAGCCCGCCCGGCCTGG - Intergenic
1071055882 10:81507154-81507176 ATGAGCCACCACGCCCGGCCTGG - Intergenic
1071086605 10:81874449-81874471 TCACGCCCCGGCGCCCTGCCCGG - Intergenic
1071096255 10:81978906-81978928 ATGAGCCACCACGCCCGGCCAGG - Intronic
1071823413 10:89300702-89300724 GTGAGCCACCACGCCCGGCCAGG - Intronic
1071824485 10:89311238-89311260 TTGAGCCACCACGCCCAGCCAGG - Intronic
1072007066 10:91262140-91262162 ATAAGCCACCACGCCTGGCCTGG - Intronic
1072184633 10:93024577-93024599 GCACACCACCACACCTGGCCTGG + Intronic
1072491174 10:95907557-95907579 TCGCGCCTCCACGCCCTGCGCGG + Intronic
1072590675 10:96826075-96826097 ACCCACCACCACGCCCAGCCCGG - Intergenic
1072593523 10:96849490-96849512 GCGAGCCACCACGCCCAGCCAGG + Intronic
1072708351 10:97698514-97698536 ATGAGCCACCACGCCCGGCCTGG - Intergenic
1072757236 10:98029724-98029746 GCATGCCCCCAAGCCCGGCCTGG + Intronic
1072875482 10:99168910-99168932 GCAAGCCACCATGCCCGGCCAGG - Intronic
1072960426 10:99924147-99924169 TACCGCCACCGCACCCGGCCTGG - Intronic
1072998233 10:100265801-100265823 ATAAGCCACCACACCCGGCCAGG + Intronic
1073016104 10:100400542-100400564 GTGAGCCACCACGCCCGGCCAGG + Intergenic
1073183225 10:101598900-101598922 ATGAGCCACCACGCCCGGCCTGG + Intronic
1073188658 10:101633826-101633848 GTAAGCCACCACGCCCAGCCTGG - Intronic
1073234199 10:101999800-101999822 ATGGGCCACCACGCCCGGCCTGG - Intronic
1073301703 10:102474928-102474950 ATGAGCCACCACGCCCGGCCAGG + Intronic
1073771436 10:106739524-106739546 ATGAGCCACCACGCCCGGCCTGG - Intronic
1073891697 10:108110260-108110282 GCCCGCCACCATGCCCTGCCCGG + Intergenic
1074340621 10:112625353-112625375 TGAAGCCGCCGCGCCCGGCCTGG - Intronic
1074574347 10:114654592-114654614 CCACACCACCATGCCCAGCCAGG + Intronic
1074745564 10:116528793-116528815 TTGAGCCACCACGCCCGGCCGGG + Intergenic
1075323749 10:121513154-121513176 GTGAGCCACCACGCCCGGCCAGG + Intronic
1075749590 10:124754340-124754362 TTGAGCCACCATGCCCGGCCGGG + Intronic
1075817561 10:125276961-125276983 TTGAGCCACCACGCCTGGCCTGG + Intergenic
1076968318 11:113766-113788 GTGAGCCACCACGCCCGGCCAGG + Intergenic
1077034105 11:486558-486580 GTGAGCCACCACGCCCGGCCAGG - Intronic
1077125300 11:932035-932057 GTGAGCCACCACGCCCGGCCAGG + Intronic
1077202855 11:1320699-1320721 GCCCGCCACCACGCCCGGCTAGG - Intergenic
1077369912 11:2177038-2177060 TCACGCCATCTTGCCCCGCCTGG + Intergenic
1077602720 11:3584671-3584693 TTGAGCCACCGCGCCCGGCCTGG + Intergenic
1079379517 11:19925466-19925488 GTAAGCCACCACACCCGGCCTGG - Intronic
1079724337 11:23861690-23861712 ATGAGCCACCACGCCCGGCCGGG + Intergenic
1080012488 11:27472546-27472568 TCACGCCAGCCGGGCCGGCCCGG + Exonic
1080506279 11:32917067-32917089 GTGAGCCACCACGCCCGGCCGGG + Intronic
1081122589 11:39285375-39285397 ATGAGCCACCACGCCCGGCCAGG + Intergenic
1081480187 11:43478956-43478978 GTGAGCCACCACGCCCGGCCTGG - Intronic
1082890140 11:58130507-58130529 ACAAGCCACCACACCCAGCCAGG - Intronic
1083412473 11:62503876-62503898 ATAAGCCACCACGCCCGGCCTGG - Intronic
1083578523 11:63810078-63810100 GTAAGCCACCACGCCCAGCCTGG + Intergenic
1083809188 11:65093669-65093691 GTAAGCCACCACGCCCTGCCTGG + Intronic
1083832973 11:65244874-65244896 GTGAGCCACCACGCCCGGCCTGG - Intergenic
1084081054 11:66825190-66825212 ATGAGCCACCACGCCCGGCCTGG - Intronic
1084175877 11:67421930-67421952 TCACGCCACTGCACCCAGCCTGG - Intronic
1084530510 11:69724916-69724938 GCATGCCACCACGCCTAGCCAGG + Intergenic
1084548722 11:69828030-69828052 CTAAGCCACCGCGCCCGGCCTGG + Intergenic
1084814135 11:71635980-71636002 TTGAGCCACCGCGCCCGGCCTGG - Intergenic
1084861552 11:72021894-72021916 GTGAGCCACCACGCCCGGCCAGG + Intronic
1084866879 11:72066021-72066043 ATGAGCCACCACGCCCGGCCCGG - Intronic
1084885100 11:72199035-72199057 ATAAGCCACCATGCCCGGCCTGG - Intergenic
1084887413 11:72220123-72220145 ACGAGCCACCACGCCCAGCCTGG + Intronic
1084993241 11:72949164-72949186 GTGAGCCACCACGCCCGGCCAGG - Intronic
1085233560 11:74993484-74993506 GTGAGCCACCACGCCCGGCCTGG + Intronic
1085433819 11:76481323-76481345 ATGAGCCACCACGCCCGGCCAGG + Intronic
1085552106 11:77383605-77383627 ATGAGCCACCACGCCCGGCCTGG + Intronic
1085810429 11:79675699-79675721 GTAAGCCACCACGCCTGGCCTGG + Intergenic
1086105310 11:83140783-83140805 GTGAGCCACCACGCCCGGCCAGG + Intergenic
1086289544 11:85291865-85291887 ATAAGCCACCACGCCTGGCCAGG + Intronic
1086950175 11:92883283-92883305 GCACACGACCACGCCCCGCCGGG - Exonic
1086970354 11:93074555-93074577 ATGAGCCACCACGCCCGGCCAGG - Intergenic
1087309956 11:96529807-96529829 TGAGGCCACCATGTCCGGCCAGG - Intergenic
1088165310 11:106927852-106927874 GTGAGCCACCACGCCCGGCCTGG + Intronic
1088259726 11:107932753-107932775 TCTGGCCACCACACCCAGCCTGG - Intronic
1088353892 11:108921675-108921697 GTGAGCCACCACGCCCGGCCAGG - Intronic
1089217323 11:116842391-116842413 GCACGCCACCATGCCCAGCTTGG + Intergenic
1089238314 11:117051859-117051881 ATGAGCCACCACGCCCGGCCTGG - Intronic
1089475950 11:118761990-118762012 ATGAGCCACCACGCCCGGCCTGG - Intronic
1090645901 11:128766601-128766623 TCAGGCCTCCCCGCCCTGCCTGG + Intronic
1090933474 11:131320737-131320759 GCAAGCCACCATGCCTGGCCAGG + Intergenic
1091490422 12:927582-927604 GTGAGCCACCACGCCCGGCCCGG - Intronic
1091551940 12:1542291-1542313 ACCCGCCACCATGCCCGGCTAGG - Intronic
1091735929 12:2921799-2921821 ATAAGCCACCACGCCCAGCCTGG - Intronic
1091897097 12:4114325-4114347 GTGAGCCACCACGCCCGGCCTGG - Intergenic
1092232514 12:6784143-6784165 ACTCGGCACCACGCCCCGCCTGG + Intergenic
1092363485 12:7857852-7857874 TCATGTCACCATGCCTGGCCTGG - Intronic
1092427821 12:8388554-8388576 TTGAGCCACCATGCCCGGCCAGG + Intergenic
1092429093 12:8395541-8395563 TTGAGCCACCATGCCCGGCCAGG + Intergenic
1092429378 12:8396830-8396852 CACCGCCACCACGCCGGGCCCGG + Intergenic
1092612309 12:10185622-10185644 GTGAGCCACCACGCCCGGCCAGG - Intronic
1092816226 12:12314510-12314532 GTGAGCCACCACGCCCGGCCTGG - Intergenic
1092887454 12:12937390-12937412 GTGAGCCACCACGCCCGGCCTGG - Intergenic
1092892061 12:12978483-12978505 GTGAGCCACCACGCCCGGCCTGG + Intronic
1092908944 12:13128179-13128201 GTGAGCCACCACGCCCGGCCTGG + Intronic
1093547876 12:20369344-20369366 TCAAGCCCCCACGGCGGGCCGGG + Exonic
1093865014 12:24216199-24216221 GTAAGCCACCGCGCCCGGCCGGG - Intergenic
1093891340 12:24525587-24525609 GTGAGCCACCACGCCCGGCCTGG - Intergenic
1094115804 12:26911115-26911137 GTAAGCCACCACACCCGGCCTGG + Intronic
1094548716 12:31429689-31429711 GTAAGCCACCACGCCCTGCCTGG + Intronic
1095043101 12:37466186-37466208 GTAAGCCACCACGCCCGGCCTGG + Intergenic
1096095786 12:48934729-48934751 GTGAGCCACCACGCCCGGCCAGG - Intronic
1096280179 12:50245949-50245971 GTGAGCCACCACGCCCGGCCTGG - Intronic
1096287625 12:50314103-50314125 GTGAGCCACCACGCCCGGCCGGG + Intergenic
1096326878 12:50670697-50670719 ATGAGCCACCACGCCCGGCCTGG + Intronic
1097211548 12:57374405-57374427 GTGAGCCACCACGCCCGGCCTGG - Intronic
1097783967 12:63738460-63738482 TCACGCCACCGCCTCCAGCCTGG - Intergenic
1097854559 12:64448914-64448936 GTGAGCCACCACGCCCGGCCTGG - Exonic
1097977064 12:65697970-65697992 GTGAGCCACCACGCCCGGCCTGG - Intergenic
1098308031 12:69120970-69120992 TTGAGCCACCACGCCCGGCCAGG - Intergenic
1098842742 12:75496144-75496166 CCATGCCACCATGCCCAGCCTGG + Exonic
1098977539 12:76918683-76918705 GTGAGCCACCACGCCCGGCCTGG + Intergenic
1099564632 12:84227982-84228004 GTGAGCCACCACGCCCGGCCTGG - Intergenic
1099822149 12:87725907-87725929 TCACGCCACTGCACCCAGCCTGG + Intergenic
1100492762 12:95097351-95097373 ATGAGCCACCACGCCCGGCCAGG - Intronic
1100585441 12:95975393-95975415 ACATGCCACCATGCCCGTCCAGG - Intronic
1101104764 12:101428924-101428946 TTGAGCCACCTCGCCCGGCCAGG - Intergenic
1101335836 12:103796232-103796254 TTGAGCCACCACGCCCGGCCAGG - Intronic
1101464603 12:104935239-104935261 ATGAGCCACCACGCCCGGCCTGG + Intronic
1101956804 12:109219047-109219069 ATGAGCCACCACGCCCGGCCTGG + Intronic
1102088168 12:110161286-110161308 ACACGCCACCATGCCTGGCTTGG + Intronic
1102243124 12:111337988-111338010 TCATGCCACTACGCTCAGCCTGG + Intronic
1102257187 12:111422977-111422999 GCGAGCCACCACGCCTGGCCAGG + Intronic
1102301767 12:111776476-111776498 GTGCGCCACCATGCCCGGCCTGG - Intronic
1102312137 12:111853815-111853837 TTAAGCCACTACGCCCGGCCTGG + Intronic
1102410125 12:112710256-112710278 TTGAGCCACCGCGCCCGGCCTGG + Intronic
1103099784 12:118163566-118163588 CCACCCCACCATGCCCAGCCAGG + Intronic
1103273127 12:119689959-119689981 GTGAGCCACCACGCCCGGCCAGG + Intronic
1103317791 12:120071010-120071032 GTGAGCCACCACGCCCGGCCTGG + Intronic
1103636759 12:122313442-122313464 ATGAGCCACCACGCCCGGCCAGG - Intronic
1103762872 12:123264174-123264196 GTGAGCCACCACGCCCGGCCTGG - Intronic
1103779445 12:123389230-123389252 TCCCGCCGCCCGGCCCGGCCAGG - Intronic
1104215543 12:126729310-126729332 ACGCACCACCACGCCCGGCTAGG + Intergenic
1104443254 12:128812596-128812618 TTGAGCCACCACGCCCAGCCTGG + Intronic
1104496465 12:129244921-129244943 GTGAGCCACCACGCCCGGCCTGG + Intronic
1105442083 13:20424049-20424071 GTGAGCCACCACGCCCGGCCGGG + Intronic
1105617882 13:22037192-22037214 ATGAGCCACCACGCCCGGCCAGG - Intergenic
1105906900 13:24820716-24820738 GTAGGCCACCACGCCCAGCCTGG + Intronic
1106126274 13:26902284-26902306 GTGAGCCACCACGCCCGGCCTGG + Intergenic
1106507052 13:30380232-30380254 AAGAGCCACCACGCCCGGCCGGG - Intergenic
1106880068 13:34119617-34119639 GCAAGCCACCACACCTGGCCTGG + Intergenic
1107015549 13:35705711-35705733 TTGAGCCACCATGCCCGGCCTGG - Intergenic
1108389468 13:49934273-49934295 GTGAGCCACCACGCCCGGCCAGG - Intronic
1108723898 13:53160346-53160368 ATAAGCCACCACGCCCGGCCTGG + Intergenic
1109974910 13:69818499-69818521 ATGAGCCACCACGCCCGGCCAGG + Intronic
1110214046 13:73006199-73006221 ATAAGCCACCACGCCTGGCCCGG + Intronic
1111564514 13:89997452-89997474 TCACACCACCACACCCGGCTAGG + Intergenic
1111735148 13:92128680-92128702 ATAAGCCACCACACCCGGCCAGG - Intronic
1112401166 13:99079755-99079777 ATGAGCCACCACGCCCGGCCTGG - Intronic
1112552192 13:100431905-100431927 TTAAGCCACCACACCCGGCCTGG - Intronic
1112568755 13:100574288-100574310 ATGAGCCACCACGCCCGGCCAGG - Intronic
1113379152 13:109786828-109786850 CCGCCCCACCCCGCCCGGCCGGG - Intergenic
1113844811 13:113380840-113380862 GTGAGCCACCACGCCCGGCCAGG - Intergenic
1114178671 14:20346473-20346495 GCCCACCACCACGCCCAGCCTGG + Intronic
1114249110 14:20942483-20942505 GTGAGCCACCACGCCCGGCCAGG + Intergenic
1114308580 14:21445396-21445418 GTGAGCCACCACGCCCGGCCAGG - Intronic
1114446419 14:22792115-22792137 TTGAGCCACCGCGCCCGGCCTGG + Intronic
1114469384 14:22948815-22948837 GTAAGCCACCGCGCCCGGCCCGG + Intronic
1114620432 14:24093394-24093416 GTGAGCCACCACGCCCGGCCTGG - Intronic
1114638150 14:24200450-24200472 ATGAGCCACCACGCCCGGCCTGG + Intronic
1114970119 14:28016368-28016390 TTGAGCCACCATGCCCGGCCTGG - Intergenic
1115181166 14:30627462-30627484 GTGAGCCACCACGCCCGGCCTGG - Intronic
1115479829 14:33850329-33850351 TTGAGCCACCACGCCCGGCCAGG + Intergenic
1115669339 14:35591596-35591618 GCAAGCCACCACACCTGGCCTGG + Intronic
1115674637 14:35657470-35657492 ACGAGCCACCACGCCTGGCCTGG + Intronic
1116009802 14:39337863-39337885 ACACACCACCATGCCCGGCCAGG + Intronic
1116451733 14:45074821-45074843 TTGAGCCACCACGCCCGGCCAGG - Intergenic
1116477726 14:45360934-45360956 ACAGGCCACCATGCCCGGCCTGG + Intergenic
1116819375 14:49613055-49613077 TTGAGCCACCACGCCTGGCCTGG - Intronic
1116894094 14:50298594-50298616 GCGAGCCACCATGCCCGGCCGGG + Intronic
1117157026 14:52951247-52951269 CCACGCCGCCCCGCCCCGCCCGG - Intronic
1117229870 14:53705554-53705576 ATGAGCCACCACGCCCGGCCAGG + Intergenic
1117398031 14:55330744-55330766 TCACGCCACTGCACTCGGCCTGG + Intronic
1117532986 14:56677006-56677028 GTAAGCCACCGCGCCCGGCCGGG + Intronic
1117655355 14:57950945-57950967 ACGAGCCACCACGCCCGGCCTGG + Intronic
1117746002 14:58870041-58870063 GTGAGCCACCACGCCCGGCCGGG - Intergenic
1117973213 14:61272499-61272521 ACACGCCACCACGGCCGGCTAGG + Intronic
1118620141 14:67607645-67607667 GTGAGCCACCACGCCCGGCCTGG + Intergenic
1118778038 14:68986115-68986137 ACACACCACCGCGCCAGGCCAGG + Intergenic
1119119683 14:72063103-72063125 ATGCGCCACCACGCCTGGCCTGG + Intronic
1119211461 14:72835347-72835369 TGAGGCCACCATGCCAGGCCAGG + Intronic
1119231885 14:72986603-72986625 TCACGCCACTGCACCCAGCCTGG - Intronic
1119241444 14:73063429-73063451 TTGAGCCACCGCGCCCGGCCCGG + Intronic
1119256788 14:73205192-73205214 GTGAGCCACCACGCCCGGCCTGG - Intronic
1119313496 14:73671016-73671038 GTGAGCCACCACGCCCGGCCAGG + Intronic
1119595863 14:75933313-75933335 ACATGCAACCACACCCGGCCTGG - Intronic
1119671372 14:76521311-76521333 GTAAGCCACCACGCCCAGCCTGG + Intergenic
1120322668 14:82985059-82985081 TCCCGCTACCACGCCCGGCTAGG + Intergenic
1121286971 14:92743517-92743539 GCAAGCCACCACACCAGGCCTGG - Intronic
1121390184 14:93566897-93566919 TTGAGCCACCACGCTCGGCCTGG + Intronic
1121742001 14:96260302-96260324 TTGAGCCACCACGCCCAGCCTGG + Intronic
1121752215 14:96366608-96366630 GCACGTCACCACACCTGGCCAGG - Intronic
1122064558 14:99163194-99163216 GTAAGCCACCACGCCTGGCCTGG + Intergenic
1122469857 14:101959011-101959033 AAGAGCCACCACGCCCGGCCTGG - Intergenic
1122572157 14:102712328-102712350 ACATGCCACCACGCCCTGCTAGG + Intronic
1122999706 14:105286751-105286773 GCCCGCCACCACGCCCGGCTGGG + Intronic
1202941642 14_KI270725v1_random:153780-153802 ATAAGCCACCACGCCTGGCCTGG + Intergenic
1123992310 15:25692946-25692968 ACATGCCACCACACCCAGCCAGG + Intronic
1124357872 15:29010538-29010560 GCGAGCCACCACACCCGGCCGGG + Intronic
1124362130 15:29045370-29045392 ATGAGCCACCACGCCCGGCCTGG + Intronic
1124770071 15:32525661-32525683 TTGAGCCACCACGCCCAGCCTGG + Intergenic
1124795197 15:32771359-32771381 ATGAGCCACCACGCCCGGCCCGG + Exonic
1125124376 15:36202395-36202417 TCACGCCACTGCACCCAGCCTGG - Intergenic
1125643676 15:41252447-41252469 GTGAGCCACCACGCCCGGCCTGG + Intronic
1125650460 15:41312908-41312930 GTGAGCCACCACGCCCGGCCAGG + Intronic
1125897788 15:43317030-43317052 ACATGCCACCATGCCTGGCCTGG - Intergenic
1125955360 15:43787279-43787301 GTGAGCCACCACGCCCGGCCAGG + Intronic
1126315562 15:47365576-47365598 GTAAGCCACCATGCCCGGCCCGG - Intronic
1126512509 15:49495739-49495761 ACGAGCCACCATGCCCGGCCCGG - Intronic
1126521527 15:49600758-49600780 GTGAGCCACCACGCCCGGCCTGG - Intronic
1126627702 15:50700912-50700934 GCACGCCACCACGCCACACCTGG - Intergenic
1126708165 15:51427010-51427032 GTGAGCCACCACGCCCGGCCAGG + Intergenic
1127094817 15:55501655-55501677 GTAAGCCACCACGCCGGGCCAGG + Intronic
1127119312 15:55757680-55757702 TTGAGCCACCACGCCTGGCCGGG - Intergenic
1127518021 15:59715059-59715081 ATGAGCCACCACGCCCGGCCGGG - Intergenic
1128221912 15:65975278-65975300 TCATGCCACCACATCTGGCCAGG + Intronic
1128295759 15:66518011-66518033 TTGAGCCACCGCGCCCGGCCTGG + Intronic
1128497155 15:68205199-68205221 TCACGCCCCCAGCCCTGGCCAGG + Intronic
1128779510 15:70349739-70349761 GTGAGCCACCACGCCCGGCCAGG - Intergenic
1129208936 15:74054254-74054276 TCGCCCTACCACGCCCTGCCTGG - Intergenic
1129281049 15:74485285-74485307 ACATGCCACCACGCCCAGCTAGG + Intergenic
1129527524 15:76229998-76230020 ATAAGCCACCGCGCCCGGCCAGG - Intronic
1129687353 15:77694469-77694491 TCACCCCACCACCCCTGCCCTGG + Intronic
1130102010 15:80901417-80901439 GTAAGCCACCACGCCTGGCCAGG - Intronic
1130621292 15:85465232-85465254 GTGAGCCACCACGCCCGGCCAGG + Intronic
1130655229 15:85787912-85787934 GCAAGCCACCACGCCCAGCTAGG - Intronic
1130939040 15:88492546-88492568 GCATGCCACCACGCCTGGCTAGG + Intergenic
1130997395 15:88911577-88911599 ACCTGCCACCACGCCCGGCCCGG - Intronic
1131336231 15:91552053-91552075 TTAAGCCACCACACCCAGCCGGG - Intergenic
1131721910 15:95178747-95178769 ACACGCCACCATGCCCAGCTAGG + Intergenic
1131838902 15:96416254-96416276 TCTCGCCAACAGGCCCCGCCTGG + Intergenic
1132051025 15:98607859-98607881 GCATGCCACCACACCCAGCCGGG + Intergenic
1132123374 15:99197382-99197404 GTGAGCCACCACGCCCGGCCTGG + Intronic
1132125732 15:99222713-99222735 TTGAGCCACCACGCCCAGCCTGG - Intronic
1132168579 15:99622980-99623002 GTGAGCCACCACGCCCGGCCCGG + Intronic
1132485895 16:190730-190752 ACCCGCCACCACGCCTGGCCAGG - Intronic
1132492269 16:238800-238822 TTGAGCCACCACGCCCAGCCAGG - Intronic
1133079043 16:3304116-3304138 GTAAGCCACCGCGCCCGGCCAGG + Intronic
1133139509 16:3733922-3733944 GTGAGCCACCACGCCCGGCCTGG + Intronic
1133472348 16:6087695-6087717 TCACGCCACGGCACCCAGCCTGG - Intronic
1133809426 16:9149603-9149625 TAAAGCCACCAGGCCTGGCCGGG + Intergenic
1134008031 16:10831362-10831384 ACAGGCCACCATGCCCCGCCTGG - Intergenic
1134539632 16:15054550-15054572 ACACGCCACCACGCCTAGCTCGG + Intronic
1134598456 16:15514506-15514528 TGAGGCCACCACGCCTGGCTGGG - Intronic
1134625047 16:15717510-15717532 GTGCGCCACCACGCCCGGCCTGG - Intronic
1134687356 16:16168207-16168229 ATGAGCCACCACGCCCGGCCTGG - Intronic
1134912411 16:18039640-18039662 GCCTGCCACCACGCCCGGCATGG + Intergenic
1135028717 16:19019130-19019152 GTGAGCCACCACGCCCGGCCAGG + Intronic
1135115962 16:19723669-19723691 TTGAGCTACCACGCCCGGCCAGG - Intronic
1135138625 16:19903273-19903295 GTGAGCCACCACGCCCGGCCTGG + Intergenic
1135257732 16:20954570-20954592 ACAAGTCACCACGCCCAGCCAGG + Intronic
1135638511 16:24099926-24099948 TCCCGCCACTACACCCAGCCTGG + Intronic
1135766761 16:25184410-25184432 GTGAGCCACCACGCCCGGCCTGG + Intergenic
1136132037 16:28228930-28228952 ATAAGCCACCACGCCTGGCCTGG + Intergenic
1136365158 16:29806373-29806395 TCCCCCCACCCCGCCCCGCCAGG + Intronic
1136787113 16:32941347-32941369 TTGAGCCATCACGCCCGGCCAGG + Intergenic
1136882662 16:33912429-33912451 TTGAGCCATCACGCCCGGCCAGG - Intergenic
1136913567 16:34162361-34162383 CCGCGCCACCGGGCCCGGCCTGG + Intergenic
1137273116 16:46916062-46916084 GTGAGCCACCACGCCCGGCCCGG - Intronic
1137435876 16:48453844-48453866 ATGAGCCACCACGCCCGGCCTGG - Intergenic
1137953079 16:52802042-52802064 GTAAGCCACCACGCCTGGCCTGG - Intergenic
1137987618 16:53123143-53123165 GTGAGCCACCACGCCCGGCCTGG + Intronic
1137988212 16:53128462-53128484 TTGAGCCACCACGCCTGGCCCGG + Intronic
1138117389 16:54371279-54371301 ATAAGCCACCACGCCCAGCCCGG - Intergenic
1138126270 16:54441297-54441319 TCACGCCACTGCACCCAGCCTGG - Intergenic
1139251098 16:65497372-65497394 GCAAGGCACCACGCCCGGCTAGG - Intergenic
1139460657 16:67119563-67119585 TCACGCCACTGCACTCGGCCTGG - Intronic
1139500769 16:67362923-67362945 GCGCGCCACCACTCCCGGCCCGG + Intronic
1139554695 16:67699764-67699786 GCAAGCCACCGCGCCCAGCCTGG + Intronic
1139818281 16:69695559-69695581 ATGAGCCACCACGCCCGGCCTGG - Intronic
1140376426 16:74448772-74448794 GTGAGCCACCACGCCCGGCCTGG - Intergenic
1140451833 16:75077108-75077130 ACGAGCCACCATGCCCGGCCTGG - Intronic
1140521175 16:75583009-75583031 TTAAGCTACCATGCCCGGCCTGG + Intergenic
1140999661 16:80296564-80296586 GTGAGCCACCACGCCCGGCCAGG + Intergenic
1141203749 16:81916918-81916940 GTGAGCCACCACGCCCGGCCAGG + Intronic
1141326560 16:83065420-83065442 ACGAGCCACCACGCCCAGCCTGG - Intronic
1141571354 16:84935713-84935735 GTGCGCCACCGCGCCCGGCCAGG - Intergenic
1141707100 16:85672275-85672297 GTGAGCCACCACGCCCGGCCGGG + Intronic
1142136983 16:88455997-88456019 TTTGGCCACCAGGCCCGGCCGGG + Intronic
1142160919 16:88557042-88557064 TTGAGCCACCACGCCCGGCCAGG - Intergenic
1142395940 16:89831677-89831699 GTAAGCCACCACGCCTGGCCTGG + Intronic
1142452360 16:90185368-90185390 GTGAGCCACCACGCCCGGCCAGG - Intergenic
1203089349 16_KI270728v1_random:1203032-1203054 TTGAGCCATCACGCCCGGCCAGG + Intergenic
1142649457 17:1338167-1338189 GTGAGCCACCACGCCCGGCCAGG - Intergenic
1142800483 17:2342129-2342151 AGCCGCCACCACACCCGGCCTGG - Intronic
1143076041 17:4344256-4344278 GCGAGCCACCGCGCCCGGCCGGG - Intronic
1143197694 17:5088728-5088750 GTGAGCCACCACGCCCGGCCAGG + Intronic
1143468030 17:7151198-7151220 GTGAGCCACCACGCCCGGCCTGG + Intergenic
1143505508 17:7362514-7362536 GTAAGCCACCGCGCCCGGCCTGG - Intergenic
1143551969 17:7635853-7635875 CGCCGCCACCACGCCCGGCTAGG - Intergenic
1143666923 17:8367978-8368000 ACACGCCACCACACCCAACCAGG - Intergenic
1143776386 17:9201903-9201925 GTGAGCCACCACGCCCGGCCCGG - Intronic
1143833184 17:9669124-9669146 CTGAGCCACCACGCCCGGCCGGG + Intronic
1143842685 17:9745475-9745497 GTGAGCCACCACGCCCGGCCAGG + Intergenic
1143901051 17:10175126-10175148 ACGAGCCACCACGCGCGGCCTGG + Intronic
1143987686 17:10929225-10929247 TCACGCCACCACACACAGCAAGG - Intergenic
1144123878 17:12182923-12182945 ATGAGCCACCACGCCCGGCCAGG + Intergenic
1144243919 17:13344067-13344089 GTACACCACCACGCCTGGCCAGG + Intergenic
1144556226 17:16285302-16285324 TTGAGCCACCGCGCCCGGCCTGG - Intronic
1144562265 17:16330526-16330548 ATGAGCCACCACGCCCGGCCTGG - Intronic
1144638641 17:16925982-16926004 TCAGGCCACCAGCCCCAGCCTGG - Intergenic
1144738153 17:17566399-17566421 TCACAGCACCAGGCCAGGCCCGG + Intronic
1144767010 17:17738387-17738409 CCACCCCACCCCGCCCCGCCAGG - Intronic
1145955081 17:28848977-28848999 GTAAGCCACCGCGCCCGGCCGGG - Intronic
1146073126 17:29702370-29702392 TTCAGCCACCACGCCCGGCCAGG - Intronic
1146194477 17:30799785-30799807 ACGAGCCACCGCGCCCGGCCAGG + Intronic
1146798247 17:35798104-35798126 ACACACCACCACGCCCGGCCAGG + Intronic
1147251532 17:39155346-39155368 GCGAGCCACCGCGCCCGGCCAGG - Intergenic
1147282613 17:39374829-39374851 TCACGCTACTACACCCAGCCTGG - Intronic
1147413236 17:40269361-40269383 ACACGCTACCACGCCTGGCTAGG - Intronic
1147483346 17:40788045-40788067 GTGAGCCACCACGCCCGGCCTGG + Intergenic
1147701249 17:42396702-42396724 ACCTGCCACCACGCCCGGCTAGG + Intergenic
1147832487 17:43306638-43306660 GCGAGCCACCACGCCTGGCCTGG + Intergenic
1147854295 17:43467106-43467128 TTGAGCCACCACGCCCGGCCAGG - Intergenic
1147866399 17:43555571-43555593 GTGAGCCACCACGCCCGGCCTGG + Intronic
1147890955 17:43716503-43716525 GTGAGCCACCACGCCCGGCCAGG - Intergenic
1148055472 17:44792027-44792049 ATGAGCCACCACGCCCGGCCCGG + Intergenic
1148395890 17:47307881-47307903 ACGCGCCACCAGGCCCAGCCTGG - Intronic
1148531612 17:48398693-48398715 GTGAGCCACCACGCCCGGCCTGG - Intronic
1148705515 17:49627129-49627151 ATGAGCCACCACGCCCGGCCAGG + Intronic
1149478756 17:56984954-56984976 GCACACCACCATGCCCAGCCCGG - Intronic
1149769460 17:59308904-59308926 GTAAGCCACCGCGCCCGGCCAGG - Intergenic
1149810387 17:59664267-59664289 GCAAGCCACCACACCTGGCCTGG - Intronic
1149824803 17:59818217-59818239 GCCCGCCACCACGGCCGGCTAGG - Intronic
1149830701 17:59869191-59869213 AGAAGCCACCATGCCCGGCCGGG - Intronic
1149897851 17:60443978-60444000 TCCTGCCACCACGCCTGGCTAGG - Exonic
1149899379 17:60459772-60459794 GTGAGCCACCACGCCCGGCCGGG + Intronic
1150226851 17:63529115-63529137 ATGAGCCACCACGCCCGGCCAGG + Intronic
1150304352 17:64071702-64071724 GTGAGCCACCACGCCCGGCCAGG + Intronic
1150416233 17:64990905-64990927 ATGAGCCACCACGCCCGGCCGGG + Intergenic
1150451419 17:65272014-65272036 ATGAGCCACCACGCCCGGCCAGG - Intergenic
1150763092 17:67980060-67980082 ATAAGCCACCACACCCGGCCTGG - Intronic
1150955365 17:69852967-69852989 GTGAGCCACCACGCCCGGCCAGG + Intergenic
1151209143 17:72531013-72531035 TTGAGCCACCACGCCCGGGCTGG - Intergenic
1151402158 17:73862820-73862842 TCAGGCCCCCACGCCCAGCTAGG - Intergenic
1151491882 17:74436702-74436724 TCACCCCACCTCCCTCGGCCAGG - Intronic
1151612744 17:75187080-75187102 AAAAGCCACCACGCCCGGCCAGG - Intergenic
1151612751 17:75187126-75187148 ATGAGCCACCACGCCCGGCCAGG - Intergenic
1151626115 17:75276963-75276985 GTGAGCCACCACGCCCGGCCAGG + Intronic
1151716091 17:75831678-75831700 GTGAGCCACCACGCCCGGCCTGG - Intronic
1151942660 17:77302395-77302417 GTGAGCCACCACGCCCGGCCAGG - Intronic
1151983942 17:77529886-77529908 GCTCGCCACCACGCCCAGCCAGG - Intergenic
1152146274 17:78570575-78570597 GTGAGCCACCACGCCCGGCCTGG - Intronic
1152382983 17:79951854-79951876 TCTCCCCACCACCCCCTGCCCGG + Intronic
1152549999 17:81024611-81024633 GCGCGCCACCACGCCTGGCTAGG - Intergenic
1152867198 17:82731311-82731333 GTGAGCCACCACGCCCGGCCTGG + Intergenic
1152998185 18:427980-428002 ATGAGCCACCACGCCCGGCCAGG - Intronic
1153298179 18:3568179-3568201 GTGAGCCACCACGCCCGGCCTGG + Intronic
1153601881 18:6788745-6788767 ATGAGCCACCACGCCCGGCCAGG + Intronic
1153724992 18:7945169-7945191 GTGAGCCACCACGCCCGGCCGGG - Intronic
1153754318 18:8264486-8264508 GTGAGCCACCACGCCCGGCCTGG - Intronic
1153862817 18:9231543-9231565 TCGAGCCACCGCGCCCGGCACGG - Intronic
1154152277 18:11915657-11915679 GTAAGCCACCACGCCCAGCCTGG - Intergenic
1154992404 18:21609371-21609393 TTGAGCCACCACGCCCAGCCTGG - Intergenic
1155429572 18:25741593-25741615 GTGAGCCACCACGCCCGGCCTGG - Intergenic
1155462688 18:26101217-26101239 ATGAGCCACCACGCCCGGCCGGG + Intergenic
1155469991 18:26181707-26181729 GCGTGCCACCACGCCTGGCCTGG - Intronic
1155593530 18:27454995-27455017 GTGAGCCACCACGCCCGGCCTGG + Intergenic
1155593886 18:27460070-27460092 TCACGCCACCGCACTCAGCCTGG - Intergenic
1155800749 18:30099808-30099830 GTAAGCCACCGCGCCCGGCCTGG + Intergenic
1156336702 18:36179177-36179199 ATGAGCCACCACGCCCGGCCCGG - Intronic
1157216526 18:45788064-45788086 GTAAGCCACCGCGCCCGGCCTGG - Intergenic
1157306774 18:46523227-46523249 ATAAGCCACCACGCCTGGCCAGG + Intronic
1157453386 18:47804630-47804652 ACACGCTACCACGCCTGGCTTGG + Intergenic
1158266598 18:55666076-55666098 GCCCGCCACCACGCCACGCCCGG + Intergenic
1158472219 18:57747168-57747190 ATGAGCCACCACGCCCGGCCTGG - Intronic
1158557810 18:58489789-58489811 ATAAGCCACCATGCCCGGCCAGG - Intronic
1158647769 18:59263217-59263239 GCCCGCCACCATGCCCGGCTAGG + Intergenic
1158843730 18:61418270-61418292 GTGAGCCACCACGCCCGGCCAGG - Intronic
1159358682 18:67371115-67371137 GTGAGCCACCACGCCCGGCCTGG + Intergenic
1159531264 18:69658233-69658255 TTAAGCCACCACGCCCAGCCTGG + Intronic
1160242833 18:77135416-77135438 CTGAGCCACCACGCCCGGCCAGG + Intergenic
1160699922 19:501201-501223 GTGAGCCACCACGCCCGGCCTGG - Intronic
1160902808 19:1437267-1437289 ATAAGCCACCACGCCCAGCCAGG + Intergenic
1160935953 19:1594784-1594806 GCCAGCCACCACGCCCGGCTGGG + Intergenic
1161008483 19:1948239-1948261 GTGAGCCACCACGCCCGGCCGGG - Intronic
1161044106 19:2125599-2125621 GTGAGCCACCACGCCCGGCCAGG + Intronic
1161109531 19:2461768-2461790 ATGAGCCACCACGCCCGGCCGGG + Intergenic
1161116304 19:2498696-2498718 GTGAGCCACCACGCCCGGCCGGG - Intergenic
1161147968 19:2690874-2690896 GCGAGCCACCGCGCCCGGCCAGG + Intronic
1161153166 19:2720220-2720242 AGACGCCACCAAGACCGGCCTGG + Intronic
1161176097 19:2842758-2842780 TTGAGCCACCGCGCCCGGCCTGG - Intronic
1161255440 19:3306473-3306495 GTGAGCCACCACGCCCGGCCTGG + Intergenic
1161289282 19:3484265-3484287 GCCCGCCACCACGCCCAGCTAGG - Intergenic
1161416679 19:4151073-4151095 ATGAGCCACCACGCCCGGCCTGG - Intergenic
1161500935 19:4615240-4615262 ACCCGCCACCATGCCTGGCCAGG + Intergenic
1161617556 19:5280434-5280456 ATGAGCCACCACGCCCGGCCAGG - Intronic
1161878217 19:6928341-6928363 GTGAGCCACCACGCCCGGCCTGG - Intronic
1162045742 19:7999088-7999110 ATAAGCCACCACGCCAGGCCAGG - Intronic
1162113666 19:8415114-8415136 ATGAGCCACCACGCCCGGCCTGG - Intronic
1162152095 19:8653944-8653966 GTAAGCCACCACGCCTGGCCTGG - Intergenic
1162173043 19:8806414-8806436 GTGAGCCACCACGCCCGGCCTGG - Exonic
1162256461 19:9494085-9494107 TCACACCACCACTCCCAGCCTGG + Intronic
1162261102 19:9534875-9534897 GTAAGCCACCATGCCCGGCCTGG + Intronic
1162364470 19:10239831-10239853 GTGAGCCACCACGCCCGGCCAGG + Intergenic
1162367993 19:10260989-10261011 GCCCGCCACCACTCCCGGCTTGG - Intergenic
1163489454 19:17608663-17608685 GCCCGCCACCACGCCTGGCTAGG + Intronic
1163577131 19:18117611-18117633 TCATGCTACCACGCCCACCCTGG - Intronic
1163659890 19:18570554-18570576 TCACGCCACTGCACCCAGCCTGG - Intergenic
1164182026 19:22827790-22827812 GTGAGCCACCACGCCCGGCCTGG - Intergenic
1164262455 19:23579906-23579928 GTGAGCCACCACGCCCGGCCGGG + Intronic
1164322168 19:24159107-24159129 GTAAGCCACCATGCCCGGCCAGG - Intergenic
1164806709 19:31122634-31122656 GTAAGCCACCACGCCTGGCCTGG - Intergenic
1165151883 19:33765840-33765862 GTGAGCCACCACGCCCGGCCAGG + Intronic
1165228444 19:34370575-34370597 GCTCGCCACCATGCCCGCCCAGG - Intronic
1165453327 19:35897524-35897546 GTGAGCCACCACGCCCGGCCTGG + Intronic
1165501964 19:36196689-36196711 ATAAGCCACCACGCCCAGCCTGG - Intronic
1165759918 19:38315095-38315117 GCAGGCCACCACGCCCGGGGTGG - Intronic
1165775898 19:38404173-38404195 TGAGCCCACCACGCCCGGCCCGG + Intronic
1165805937 19:38580575-38580597 TGGAGGCACCACGCCCGGCCTGG - Intronic
1165844708 19:38810757-38810779 GTAAGCCACCATGCCCGGCCAGG + Intronic
1165883011 19:39056811-39056833 GCACGCCACCACCCCCGGGTAGG + Intergenic
1165934270 19:39379850-39379872 TTGAGCCACCACGCCCGGCCAGG + Intronic
1165967612 19:39596388-39596410 GTAAGCCACCACGCCTGGCCAGG - Intergenic
1166206871 19:41275818-41275840 GTGAGCCACCACGCCCGGCCTGG - Intronic
1166550160 19:43660453-43660475 TTGAGCCACCATGCCCGGCCTGG + Intronic
1166577520 19:43856301-43856323 GTGAGCCACCACGCCCGGCCAGG + Intergenic
1166684269 19:44786213-44786235 GCACGCCACCACGCCCGGCTGGG + Intronic
1166809455 19:45506938-45506960 TCACCCCACCCCGCCCGCCCCGG - Intronic
1166876269 19:45899555-45899577 CTGAGCCACCACGCCCGGCCTGG - Intronic
1167131312 19:47587911-47587933 GCGAGCCACCACGCCCGGCCTGG + Intergenic
1167230645 19:48280833-48280855 ACGAGCCACCATGCCCGGCCAGG + Intronic
1167311040 19:48738225-48738247 GTGAGCCACCACGCCCGGCCAGG + Intronic
1167342718 19:48925378-48925400 CTGAGCCACCACGCCCGGCCAGG + Intergenic
1167374880 19:49105446-49105468 GCGAGCCACCACGCCTGGCCTGG - Intronic
1167402550 19:49282516-49282538 GCCCGCCACCACGCCCAGCTAGG - Intergenic
1167590290 19:50400976-50400998 TTGAGCCACCGCGCCCGGCCTGG + Intronic
1167750098 19:51374234-51374256 GTGAGCCACCACGCCCGGCCAGG + Intergenic
1167788762 19:51657816-51657838 ACGAGCCACCATGCCCGGCCAGG - Intergenic
1167949208 19:53012879-53012901 GTGAGCCACCACGCCCGGCCGGG - Intergenic
1168026972 19:53649447-53649469 CTGAGCCACCACGCCCGGCCTGG - Intergenic
1168055583 19:53862921-53862943 GTGAGCCACCACGCCCGGCCCGG - Intergenic
1168210844 19:54888918-54888940 TCACGCCACCACGCCCGGCCAGG - Intronic
1168255342 19:55161686-55161708 TCCCGCTACGACGCCCGGCGCGG - Exonic
1168619626 19:57867728-57867750 ACGTGCCACCACGCCCGGCTAGG - Intronic
1168642256 19:58038230-58038252 TCAGGCCCCCTGGCCCGGCCCGG - Intronic
1168697479 19:58412489-58412511 GTGAGCCACCACGCCCGGCCTGG + Intronic
927429136 2:23012179-23012201 ACCCGCCACCACGCCCGGCTAGG + Intergenic
927472413 2:23385861-23385883 CCCCGCTCCCACGCCCGGCCCGG - Intronic
927607782 2:24503777-24503799 TCACACCACCACATCCAGCCTGG - Intronic
927686654 2:25175785-25175807 TTGAGCCACCACGCCTGGCCTGG - Intergenic
927995703 2:27484307-27484329 ATGAGCCACCACGCCCGGCCTGG - Intronic
928497624 2:31850340-31850362 GTGAGCCACCACGCCCGGCCAGG - Intergenic
928628114 2:33161547-33161569 GTGAGCCACCACGCCCGGCCAGG + Intronic
928707014 2:33961096-33961118 GCGAGCCACCACGCCCGGCCTGG - Intergenic
929136492 2:38628659-38628681 ATGAGCCACCACGCCCGGCCTGG + Intergenic
929535442 2:42780783-42780805 ATGAGCCACCACGCCCGGCCGGG - Intronic
929536864 2:42789296-42789318 ATGAGCCACCACGCCCGGCCGGG - Intronic
929814669 2:45221440-45221462 TCTCGCCACCATGGCTGGCCAGG + Intergenic
929893816 2:45940774-45940796 ATGAGCCACCACGCCCGGCCAGG - Intronic
930080084 2:47439336-47439358 GCCCACCACCACGCCCGGCTAGG - Intronic
930082964 2:47469302-47469324 GTAAGCCACCATGCCCGGCCAGG - Intronic
930647537 2:53927797-53927819 ACACGCCACCATGCCTGGCTGGG - Intronic
930769148 2:55114414-55114436 GTGAGCCACCACGCCCGGCCTGG - Intergenic
931049381 2:58393577-58393599 GTAAGCCACCGCGCCCGGCCAGG + Intergenic
931101424 2:59005867-59005889 TCCTCCCACCACGCCCAGCCAGG - Intergenic
931751143 2:65331123-65331145 TTTAGCCACCACGCCCAGCCTGG - Intronic
932218020 2:69979313-69979335 GTGAGCCACCACGCCCGGCCAGG + Intergenic
932722153 2:74146273-74146295 ATGAGCCACCACGCCCGGCCAGG + Intronic
933037726 2:77421423-77421445 ATGAGCCACCACGCCCGGCCTGG - Intronic
933315593 2:80710652-80710674 ACGAGCCACCGCGCCCGGCCTGG - Intergenic
933693354 2:85196650-85196672 GCAAGCCACCACACCCAGCCCGG + Intronic
934988617 2:98904966-98904988 TTGAGCCACCGCGCCCGGCCGGG - Intronic
935070011 2:99685902-99685924 TTGAGCCACCATGCCCGGCCTGG - Intronic
935291077 2:101611545-101611567 GTGAGCCACCACGCCCGGCCTGG - Intergenic
935429316 2:102957667-102957689 TTGAGCCACCACGCCTGGCCAGG - Intergenic
935531220 2:104234632-104234654 ATAAGCCACCATGCCCGGCCTGG - Intergenic
935623140 2:105145797-105145819 GTAAGCCACCACGCCCAGCCAGG + Intergenic
935819355 2:106878477-106878499 ACATGCCACCACGCTCAGCCTGG - Intronic
936388802 2:112054611-112054633 CCCCGCCTCCACGCTCGGCCTGG + Intergenic
936388846 2:112054743-112054765 CCCCGCCTCCACGCTCGGCCTGG + Intergenic
936388932 2:112054987-112055009 CCCCGCCTCCACGCTCGGCCTGG + Intergenic
936416732 2:112322256-112322278 TCACGCCACTACACCCAGCCTGG - Intronic
936441815 2:112560772-112560794 ATGGGCCACCACGCCCGGCCAGG - Intronic
936793123 2:116174243-116174265 GTGAGCCACCACGCCCGGCCTGG - Intergenic
937147658 2:119661189-119661211 ACACACCACCACGCCTGGCTAGG - Intronic
937250442 2:120520297-120520319 GCACGCCACCACACCTGGCTTGG - Intergenic
937433795 2:121863501-121863523 TTGAGCCACCACGCCCAGCCTGG - Intergenic
937864954 2:126743428-126743450 GCGAGCCACCATGCCCGGCCTGG - Intergenic
937950938 2:127387649-127387671 GCCCGCCACCCCGCCCGGCCCGG - Intronic
938125823 2:128670671-128670693 GTGAGCCACCACGCCCGGCCTGG - Intergenic
938420900 2:131145898-131145920 ATGAGCCACCACGCCCGGCCCGG - Intronic
938728499 2:134127603-134127625 TGACTCCAGCACGCCAGGCCTGG - Intronic
938955434 2:136293580-136293602 TTGAGCCACCATGCCCGGCCAGG + Intergenic
938961254 2:136343572-136343594 ATGAGCCACCACGCCCGGCCTGG - Intergenic
939232761 2:139451462-139451484 GCCCACCACCACGCCCGGCTAGG - Intergenic
939325181 2:140679057-140679079 ATGAGCCACCACGCCCGGCCAGG + Intronic
939590066 2:144053903-144053925 GTGAGCCACCACGCCCGGCCAGG - Intronic
939895250 2:147783887-147783909 ACCCGCCACCACGCCTGGCTAGG - Intergenic
940226984 2:151410312-151410334 TCACACCCGCACGCCCGCCCGGG - Exonic
940276309 2:151944320-151944342 ATAAGCCACCACGTCCGGCCTGG + Intronic
940549714 2:155138624-155138646 GTAAGCCACCACACCCGGCCTGG + Intergenic
941627854 2:167849603-167849625 TTGAGCCACCGCGCCCGGCCAGG - Intergenic
942039475 2:172044445-172044467 GCATGCCACCACGCCCAGCTAGG - Intronic
942556242 2:177175214-177175236 ACGAGCCACCATGCCCGGCCAGG - Intergenic
943054282 2:182956320-182956342 GTGAGCCACCACGCCCGGCCCGG + Intronic
943357563 2:186876272-186876294 ATGAGCCACCACGCCCGGCCAGG - Intergenic
943364416 2:186955777-186955799 ATGAGCCACCACGCCCGGCCAGG - Intergenic
943844260 2:192623276-192623298 GTAAGCCACCACGCCCTGCCTGG - Intergenic
943851915 2:192734594-192734616 GTGAGCCACCACGCCCGGCCAGG - Intergenic
944104338 2:196063162-196063184 ATAAGCCACCACGCCTGGCCAGG + Intronic
944205689 2:197156062-197156084 GTGAGCCACCACGCCCGGCCCGG - Intronic
944449001 2:199821743-199821765 ATAAGCCACCACGCCCAGCCTGG + Intronic
944695435 2:202196475-202196497 GTGAGCCACCACGCCCGGCCAGG + Intronic
944717954 2:202394065-202394087 ATGAGCCACCACGCCCGGCCAGG - Intronic
944741870 2:202620376-202620398 GCGAGCCACCACGCCAGGCCAGG - Intergenic
944793652 2:203160361-203160383 GTGAGCCACCACGCCCGGCCTGG + Intronic
945225882 2:207530492-207530514 TCCCGGCTCCGCGCCCGGCCCGG - Intronic
945439096 2:209857070-209857092 GTAAGCCACCACGCCTGGCCTGG + Intronic
946494368 2:220181073-220181095 ACATGCCACCATGCCCAGCCTGG - Intergenic
946595100 2:221297486-221297508 TCATGCCACTGCGCCCAGCCTGG - Intergenic
946764315 2:223025824-223025846 ATGAGCCACCACGCCCGGCCTGG - Intergenic
946780096 2:223185864-223185886 ATGAGCCACCACGCCCGGCCAGG - Intronic
947552303 2:231055184-231055206 GTAAGCCACCGCGCCCGGCCAGG + Intergenic
947840677 2:233205794-233205816 ATGAGCCACCACGCCCGGCCTGG - Intronic
948008530 2:234631767-234631789 GCACGCCACCACACCCAGCATGG + Intergenic
948237054 2:236399270-236399292 GCAAGCCACCTCGCCTGGCCAGG + Intronic
948744206 2:240074231-240074253 GTGAGCCACCACGCCCGGCCAGG + Intergenic
949000513 2:241610374-241610396 TCACGCCACCGCGCCCTGTTTGG + Intronic
949018185 2:241725320-241725342 CCCCGCCCGCACGCCCGGCCGGG - Exonic
949083802 2:242130017-242130039 GTGAGCCACCACGCCCGGCCAGG - Intergenic
1168821315 20:775419-775441 CCATGCCACCACGTCCGACCTGG + Intergenic
1169053008 20:2596347-2596369 GTGAGCCACCACGCCCGGCCCGG - Intronic
1169166478 20:3428635-3428657 GTGAGCCACCACGCCCGGCCTGG - Intergenic
1169454923 20:5744129-5744151 ACGAGCCACCACGCCTGGCCTGG - Intergenic
1169504472 20:6193923-6193945 TCACACCACTACGTCCAGCCTGG - Intergenic
1169676429 20:8159703-8159725 ATGAGCCACCACGCCCGGCCTGG - Intronic
1169697106 20:8402550-8402572 ATGAGCCACCACGCCCGGCCTGG - Intronic
1169770770 20:9197691-9197713 ATGCGCCACCGCGCCCGGCCTGG - Intronic
1169886932 20:10410346-10410368 ATGAGCCACCACGCCCGGCCTGG - Intronic
1169938846 20:10915234-10915256 GTGAGCCACCACGCCCGGCCCGG - Intergenic
1170260373 20:14399165-14399187 ACACGCCACCACAACCGGCTAGG + Intronic
1170889144 20:20364473-20364495 GGCCGCCACCCCGCCCGGCCCGG - Intergenic
1171537532 20:25908934-25908956 GTAAGCCACCACGCCCAGCCTGG + Intergenic
1171803544 20:29651558-29651580 GTAAGCCACCACGCCCTGCCTGG - Intergenic
1171810499 20:29742230-29742252 CCGCGCCACCGGGCCCGGCCTGG - Intergenic
1171871989 20:30535599-30535621 TTGAGCCACCACGCCCAGCCTGG + Intergenic
1171998511 20:31752655-31752677 TCACGCCACCGCATCCAGCCTGG - Intronic
1172118161 20:32583811-32583833 CCACGCCACCCCGCCCGGACCGG + Intronic
1172289925 20:33768703-33768725 ATGAGCCACCACGCCCGGCCTGG + Intronic
1172295913 20:33811277-33811299 ACAGGCCCCCACGCCCGGCCCGG - Intergenic
1172360121 20:34306649-34306671 GTAAGCCACCACGCCCAGCCAGG + Intronic
1172553706 20:35822268-35822290 TCACACCACCATGCCCAGCTAGG - Intronic
1173459226 20:43229476-43229498 GTAAGCCACCATGCCCGGCCTGG + Intergenic
1173993994 20:47323916-47323938 GTGAGCCACCACGCCCGGCCAGG - Intronic
1174301117 20:49583233-49583255 ACATGCCACCACGCCTGGCTAGG - Intergenic
1174472516 20:50771178-50771200 GTAAGCCACCACACCCGGCCAGG - Intergenic
1174614479 20:51825297-51825319 GCGAGCCACCACGCCCGGCTTGG - Intergenic
1174638400 20:52021564-52021586 GCCCGCCACCATGCCTGGCCAGG - Intergenic
1174810908 20:53644833-53644855 ACCCGCCACCACACCCAGCCTGG - Intergenic
1175123808 20:56736790-56736812 TTGAGCCACCACGCCCGGCCTGG - Intergenic
1175345542 20:58271039-58271061 GTGAGCCACCACGCCCGGCCAGG + Intergenic
1175992146 20:62794888-62794910 TTGAGCCACCGCGCCCGGCCGGG - Intergenic
1176016873 20:62938304-62938326 TCCCGCCTGCCCGCCCGGCCCGG - Intronic
1176168086 20:63685023-63685045 ACATGCCACCATGCCCGGCTAGG + Intronic
1176382784 21:6121398-6121420 TGCCCCCACCACGCCTGGCCAGG + Exonic
1176512116 21:7756576-7756598 GCACGCCACCACACCCGGCTAGG + Intronic
1176581523 21:8533152-8533174 ATAAGCCACCACGCCTGGCCTGG - Intergenic
1177019644 21:15838210-15838232 TGAAGCCACCATGCCAGGCCTGG + Intronic
1177194394 21:17887415-17887437 ACATGCCACCACGCCCAGCTAGG - Intergenic
1178101010 21:29268571-29268593 GTGAGCCACCACGCCCGGCCAGG - Intronic
1178474885 21:32929313-32929335 ATGAGCCACCACGCCCGGCCAGG - Intergenic
1178499616 21:33115095-33115117 ACAGGCCACCATGCCCAGCCCGG + Intergenic
1178623949 21:34200159-34200181 GCACGCCACCACGCCAGGCTGGG + Intergenic
1178646228 21:34387101-34387123 GCACGCCACCACACCCGGCTAGG + Intronic
1179143906 21:38751181-38751203 GTGAGCCACCACGCCCGGCCGGG - Intergenic
1179395451 21:41036055-41036077 GTGAGCCACCACGCCCGGCCAGG - Intergenic
1179740685 21:43416841-43416863 TGCCCCCACCACGCCTGGCCAGG - Exonic
1179990517 21:44946014-44946036 GTGAGCCACCACGCCCGGCCTGG + Intronic
1180264359 22:10510225-10510247 ATAAGCCACCACGCCTGGCCTGG - Intergenic
1181097112 22:20513020-20513042 ATGAGCCACCACGCCCGGCCGGG + Intronic
1181184276 22:21091229-21091251 TCACGCCACTGCACCCAGCCTGG - Intergenic
1181478948 22:23185381-23185403 TTGAGCCACCGCGCCCGGCCGGG - Intronic
1181652767 22:24269990-24270012 CTAAGCCACCGCGCCCGGCCGGG + Intergenic
1181730174 22:24840224-24840246 GTGAGCCACCACGCCCGGCCTGG + Intronic
1181794446 22:25294857-25294879 TTGAGCCACCACGCCCGGCCAGG - Intergenic
1181806959 22:25380653-25380675 TCACACCACCACCCCCACCCTGG - Intronic
1182281797 22:29221654-29221676 GTGAGCCACCACGCCCGGCCAGG + Intronic
1182324868 22:29504872-29504894 GCGTGCCACCACGCCCAGCCAGG - Intergenic
1182474605 22:30569802-30569824 GCACGCCACCGTGCCCGGCTGGG - Intronic
1182669386 22:31983231-31983253 ATGAGCCACCACGCCCGGCCAGG - Intergenic
1182719315 22:32384762-32384784 GTGAGCCACCACGCCCGGCCAGG + Intergenic
1183002155 22:34869668-34869690 GTGAGCCACCACGCCCGGCCTGG + Intergenic
1183061519 22:35339046-35339068 GTGAGCCACCACGCCCGGCCTGG - Intronic
1183489268 22:38108094-38108116 CCCCGCCACCACTCCCTGCCGGG - Intronic
1183536151 22:38402533-38402555 TCGAGCCACCGCGCCCGGCTGGG - Intergenic
1183573595 22:38672596-38672618 ATGAGCCACCACGCCCGGCCTGG + Intronic
1183785024 22:40024277-40024299 ACAAGCCACCGCGCCTGGCCAGG + Intronic
1183910503 22:41075418-41075440 ACACGCCACCATGCCCAGCCAGG + Intergenic
1183981830 22:41545075-41545097 GTACACCACCACGCCCGGCTTGG - Intergenic
1184107480 22:42376662-42376684 CCCCGCCACCACCCCTGGCCGGG + Intergenic
1184215038 22:43061040-43061062 GCACGCCACCACACCTGGCTGGG - Intronic
1184429376 22:44432329-44432351 GTGAGCCACCACGCCCGGCCAGG - Intergenic
1184485100 22:44773096-44773118 GCAAGCCACCAAGCCTGGCCAGG + Intronic
1184540054 22:45116199-45116221 GTGAGCCACCACGCCCGGCCAGG - Intergenic
1184554732 22:45227038-45227060 TCACTCCTCCACTCCCTGCCCGG + Intronic
1184804890 22:46788216-46788238 GTGAGCCACCACGCCCGGCCAGG + Intronic
1185217477 22:49609754-49609776 TCAAGCCCCCACCCCAGGCCAGG + Intronic
1185266842 22:49908667-49908689 GTGAGCCACCACGCCCGGCCCGG - Intronic
1185400806 22:50615285-50615307 GCAAGCCATCACGCCCAGCCAGG - Intergenic
949307690 3:2661528-2661550 ACGAGCCACCACGCCTGGCCAGG - Intronic
949956988 3:9277315-9277337 GTAAGCCACCATGCCCGGCCTGG - Intronic
949957206 3:9278989-9279011 GTGCACCACCACGCCCGGCCAGG - Intronic
949998273 3:9636177-9636199 TTAAGCCACCACGCCTGGCAAGG + Intergenic
950015586 3:9752766-9752788 GTGAGCCACCACGCCCGGCCAGG - Intronic
950015690 3:9753368-9753390 GTGAGCCACCACGCCCGGCCAGG - Intronic
950111333 3:10420642-10420664 ATGAGCCACCACGCCCGGCCTGG + Intronic
950272591 3:11630360-11630382 GTGAGCCACCACGCCCGGCCAGG - Intronic
950284457 3:11733775-11733797 GTGAGCCACCACGCCCGGCCAGG + Intergenic
950285404 3:11740936-11740958 GTGAGCCACCACGCCCGGCCTGG - Intergenic
950604092 3:14062892-14062914 GCATGCCACCATGCCTGGCCTGG - Intronic
950782309 3:15402449-15402471 GTAAGCCACCATGCCCGGCCAGG - Intronic
950796815 3:15516864-15516886 TACAGCCACCACGCCTGGCCTGG - Intronic
950966141 3:17147338-17147360 ATAAGCCACCACGCCCAGCCCGG - Intergenic
951444839 3:22766657-22766679 GTGAGCCACCACGCCCGGCCAGG - Intergenic
952211426 3:31232383-31232405 TCACCCCACCCCTCACGGCCAGG + Intergenic
953349074 3:42201174-42201196 GCGAGCCACCACGCCCGGCCAGG - Intronic
953617782 3:44507594-44507616 GTGAGCCACCACGCCCGGCCTGG + Intronic
953675800 3:45001169-45001191 ATGAGCCACCACGCCCGGCCAGG - Intronic
953893624 3:46776166-46776188 ACATGCCACCATGCCCGGCTAGG - Intronic
953937656 3:47059698-47059720 ACAAGCCACCACGCCTGGCTGGG + Intronic
953985738 3:47441180-47441202 GTGAGCCACCACGCCCGGCCAGG + Intronic
954003386 3:47575141-47575163 GTGAGCCACCACGCCCGGCCAGG - Intronic
954153491 3:48671720-48671742 ATAAGCCACCACGCCTGGCCTGG - Intergenic
954255823 3:49405108-49405130 GCCCGCCACCACGCCCGGCTAGG - Intronic
954310277 3:49761342-49761364 GTGAGCCACCACGCCCGGCCAGG - Intronic
954312665 3:49782449-49782471 TTGAGCCACCGCGCCCGGCCTGG + Intronic
954333816 3:49904644-49904666 GTAAGCCACCGCGCCCGGCCGGG + Intronic
954667629 3:52265857-52265879 TTAAGCCACCACGCCTGGCCTGG + Intronic
954785250 3:53087801-53087823 GCAAGCCACAACGCCTGGCCCGG + Intronic
955151292 3:56369955-56369977 ATGAGCCACCACGCCCGGCCTGG + Intronic
955321030 3:57974456-57974478 GTGAGCCACCACGCCCGGCCGGG - Intergenic
955351249 3:58194908-58194930 GTGAGCCACCACGCCCGGCCCGG + Intronic
955361826 3:58282447-58282469 GCAAGCCACCATGCCCAGCCAGG - Intronic
955373721 3:58376130-58376152 GTGAGCCACCACGCCCGGCCAGG - Intronic
955742131 3:62102551-62102573 GTGAGCCACCACGCCCGGCCTGG + Intronic
957153232 3:76513501-76513523 TCACACCACCACGCCTGGCGTGG + Intronic
958128847 3:89391462-89391484 TCACGCCACTGCACCCAGCCTGG - Intronic
958142079 3:89573990-89574012 TCCCACCACCACACTCGGCCTGG + Intergenic
959944363 3:112111581-112111603 TCAGGCCACCTAGCCTGGCCTGG - Intronic
960306072 3:116062224-116062246 ATAGGCCACCATGCCCGGCCTGG - Intronic
960588725 3:119345266-119345288 GTGTGCCACCACGCCCGGCCCGG + Intronic
960648734 3:119921853-119921875 GCAAGCCACCACGCCTGGCCAGG - Intronic
960678202 3:120218103-120218125 ACGAGCCACCACGCCTGGCCAGG + Intronic
960790895 3:121429671-121429693 GTGAGCCACCACGCCCGGCCAGG + Intergenic
961212155 3:125133853-125133875 ACAAGCCACCACGCCAGGCCAGG + Intronic
961223079 3:125215311-125215333 GCAAGCCACCTCGCCCAGCCAGG - Intergenic
961540605 3:127596832-127596854 GTGAGCCACCACGCCCGGCCAGG - Intronic
961697607 3:128716657-128716679 TCACACCACTACACCCGGCCTGG - Intergenic
962552636 3:136510757-136510779 GCACGCCACCATGCCCAGCTAGG + Intronic
962796375 3:138852999-138853021 GAGAGCCACCACGCCCGGCCTGG + Intergenic
963186975 3:142429428-142429450 GCGAGCCACCACGCCCGGCCTGG + Intronic
963212042 3:142703576-142703598 GTAAGCGACCACGCCCGGCCTGG + Intronic
963417518 3:145016737-145016759 GTGAGCCACCACGCCCGGCCAGG - Intergenic
963457278 3:145560317-145560339 ACATGCCACCACACCCAGCCTGG + Intergenic
963539857 3:146571717-146571739 GTAAGCCACCGCGCCCGGCCTGG - Intergenic
964207348 3:154189060-154189082 TCACTCCACCACGCCCTGGTGGG + Intronic
964234232 3:154506572-154506594 ATGAGCCACCACGCCCGGCCTGG - Intergenic
964436083 3:156655428-156655450 GTGAGCCACCACGCCCGGCCGGG - Intergenic
964594479 3:158408747-158408769 ACGAGCCACCACGCCTGGCCTGG - Intronic
965478200 3:169184144-169184166 TTGAGCCACCACGCCTGGCCAGG + Intronic
965526902 3:169730405-169730427 ACACGCCACCATGCCATGCCTGG + Intergenic
965784012 3:172317464-172317486 GTGAGCCACCACGCCCGGCCGGG + Intronic
965958877 3:174405358-174405380 GTTAGCCACCACGCCCGGCCTGG - Intergenic
966380961 3:179344816-179344838 TTGAGCCACCGCGCCCGGCCTGG + Intergenic
966876994 3:184328099-184328121 ATAAGCCACCACACCCGGCCAGG - Intronic
966879600 3:184342586-184342608 ATAAGCCACCACACCCGGCCAGG + Intronic
966909845 3:184553070-184553092 ATGAGCCACCACGCCCGGCCAGG + Intronic
967025097 3:185557725-185557747 ATAAGCCACCACGCCCAGCCTGG - Intergenic
967055340 3:185825105-185825127 TCCCCCCACCGCGGCCGGCCCGG + Intergenic
967906137 3:194501888-194501910 TCACGCCACTGCACCCAGCCTGG + Intergenic
968163207 3:196443907-196443929 GTGAGCCACCACGCCCGGCCTGG + Intergenic
968168528 3:196489136-196489158 GTGAGCCACCACGCCCGGCCTGG + Intronic
968235014 3:197026368-197026390 GCCCGGCACCACGCCAGGCCCGG + Intronic
968634920 4:1673053-1673075 TATCACCACCACGCCTGGCCTGG + Intronic
968940484 4:3634945-3634967 TCAGGCCACCCTGCCCTGCCAGG + Intergenic
969032079 4:4223615-4223637 ATGGGCCACCACGCCCGGCCTGG - Intronic
969400097 4:6948913-6948935 GTAAGCCACCACGCCCGGCCAGG - Intronic
969580656 4:8062719-8062741 ATGAGCCACCACGCCCGGCCTGG + Intronic
970121259 4:12755014-12755036 GTAAGCCACCACGCCCTGCCAGG + Intergenic
970518815 4:16862349-16862371 GTAAGCCAGCACGCCCGGCCAGG - Intronic
970612812 4:17741409-17741431 GTGAGCCACCACGCCCGGCCAGG - Intronic
971205807 4:24567294-24567316 AGCCGCCACCACGCCCAGCCTGG - Intronic
972514705 4:39800868-39800890 GTGAGCCACCACGCCCGGCCAGG - Intergenic
972527621 4:39931234-39931256 ACACGCCACCACACCTGGCTAGG + Intronic
972573204 4:40329208-40329230 ACATGCCACCAAGCCCAGCCAGG - Intergenic
972736805 4:41850196-41850218 TTGAGCCACCACGCCCGGCCTGG - Intergenic
973774720 4:54232866-54232888 GTAAGCCACCGCGCCCGGCCAGG + Intronic
974726063 4:65799766-65799788 TTGAGCCACCGCGCCCGGCCAGG + Intergenic
975143468 4:70940953-70940975 GTGAGCCACCACGCCCGGCCCGG + Intronic
975200110 4:71577555-71577577 ATGAGCCACCACGCCCGGCCAGG - Intergenic
975573219 4:75838670-75838692 TTGAGCCACCATGCCCGGCCTGG - Intergenic
975641767 4:76507684-76507706 GCCCGCCACCATGCCTGGCCTGG + Intronic
975904112 4:79188996-79189018 ACCTGCCACCACGCCCGGCTCGG - Intergenic
976088721 4:81432940-81432962 TTATGCCACCACACCCAGCCAGG - Intronic
976120673 4:81777731-81777753 TCACTCCACCTCCCCCGGACAGG + Intronic
976742784 4:88374302-88374324 GTGAGCCACCACGCCCGGCCAGG - Intergenic
977615778 4:99086660-99086682 TTGAGCCACCGCGCCCGGCCAGG - Intronic
977965647 4:103144216-103144238 TCGAGCCACCGCGCCCGGCCTGG + Intronic
978375213 4:108067983-108068005 GTGAGCCACCACGCCCGGCCCGG - Intronic
978723904 4:111947622-111947644 ATAAGCCACCGCGCCCGGCCTGG - Intergenic
979261241 4:118648298-118648320 GTGAGCCACCACGCCCGGCCAGG - Intergenic
979481463 4:121223085-121223107 GCAAGCCACCGCGCCCAGCCAGG + Intronic
979536675 4:121829538-121829560 GTGAGCCACCACGCCCGGCCAGG + Intronic
979538744 4:121855165-121855187 GCACACCACCATGCCCGGCTAGG - Intronic
980947258 4:139333853-139333875 TCACGCCACTGTGCCCTGCCTGG + Intronic
980957371 4:139443272-139443294 TTGAGCCACCGCGCCCGGCCTGG + Intergenic
981053268 4:140332657-140332679 ATAAGCCACCGCGCCCGGCCTGG + Intronic
981135426 4:141206135-141206157 GTGAGCCACCACGCCCGGCCAGG - Intronic
981385891 4:144130119-144130141 GCACACCACCATGCCTGGCCTGG + Intronic
981435864 4:144721616-144721638 GTGAGCCACCACGCCCGGCCTGG - Intronic
981581436 4:146252158-146252180 ATGAGCCACCACGCCCGGCCTGG - Intergenic
982003008 4:151038236-151038258 GCAAGCCACCATGCCCAGCCTGG + Intergenic
982234585 4:153240794-153240816 GTGAGCCACCACGCCCGGCCAGG - Intronic
982251391 4:153410706-153410728 ATGAGCCACCACGCCCGGCCAGG - Intronic
982468414 4:155759176-155759198 TCACCCCTCCTCGGCCGGCCTGG + Intronic
982885093 4:160769241-160769263 GTGAGCCACCACGCCCGGCCAGG - Intergenic
982915820 4:161207839-161207861 GTGAGCCACCACGCCCGGCCAGG - Intergenic
982926273 4:161340624-161340646 GGAAGCCACCTCGCCCGGCCCGG - Intergenic
983150602 4:164274956-164274978 GTAAGCCACCACGCCCGGCCAGG + Intronic
983547839 4:168981115-168981137 GCGAGCCACCACGCCTGGCCTGG - Intronic
983574035 4:169240946-169240968 GTGAGCCACCACGCCCGGCCTGG - Intronic
983648831 4:170018868-170018890 TCACTGCCCCACCCCCGGCCAGG - Intronic
984238545 4:177191457-177191479 GCACCCCACCACTCCCAGCCAGG - Intergenic
984456390 4:179974658-179974680 TTGAGCCACCGCGCCCGGCCAGG + Intergenic
984582630 4:181527598-181527620 TCAAGCCACCATGCCCAGCCAGG + Intergenic
984711340 4:182887912-182887934 GCGAGCCACCACACCCGGCCAGG + Intergenic
984735506 4:183103914-183103936 ATGAGCCACCACGCCCGGCCTGG + Intronic
985055023 4:186028604-186028626 GTAAGCCACCACGCCCAGCCAGG - Intergenic
985875601 5:2591621-2591643 TCACACCCCCAGGCCCAGCCTGG - Intergenic
985944482 5:3166810-3166832 GTAAGCCACCACGCCTGGCCAGG - Intergenic
987041191 5:14064381-14064403 TTAGGCCACCGCGTCCGGCCTGG - Intergenic
987298311 5:16574027-16574049 ACAAGCCACAACGCCCGGCTGGG + Intronic
988461834 5:31446162-31446184 GTGAGCCACCACGCCCGGCCTGG - Intronic
988780888 5:34521066-34521088 TTGAGCCACCGCGCCCGGCCAGG - Intergenic
989157508 5:38358161-38358183 ATGAGCCACCACGCCCGGCCAGG - Intronic
989626499 5:43434586-43434608 GCCCGCCACCACGCCTGGCTAGG + Intergenic
989770913 5:45144143-45144165 ATGAGCCACCACGCCCGGCCTGG + Intergenic
990081232 5:51915918-51915940 GTAAGCCACCATGCCCGGCCTGG + Intergenic
990390114 5:55310326-55310348 GTGAGCCACCACGCCCGGCCAGG - Intronic
990447339 5:55904911-55904933 ACGAGCCACCACGCCCAGCCAGG - Intronic
990722294 5:58710314-58710336 GTGAGCCACCACGCCCGGCCTGG - Intronic
990729528 5:58793274-58793296 ACGAGCCACCGCGCCCGGCCAGG - Intronic
991363196 5:65842356-65842378 GCCCGCCGCCACGCCCGGCCAGG + Intronic
991573816 5:68082158-68082180 ACAAGCCACCACACCTGGCCAGG - Intergenic
991600979 5:68351060-68351082 GTGAGCCACCACGCCCGGCCTGG + Intergenic
991691637 5:69231092-69231114 ATAAGCCACCACACCCGGCCTGG - Intergenic
991779204 5:70116139-70116161 GTAAGCCACCACGCCTGGCCAGG - Intergenic
991858496 5:70991612-70991634 GTAAGCCACCACGCCTGGCCAGG - Intronic
991871654 5:71116495-71116517 GTAAGCCACCACGCCTGGCCAGG - Intergenic
991909741 5:71550101-71550123 GCAAGCCACCACGCCTGGCCAGG - Intronic
992110527 5:73488441-73488463 GTGAGCCACCACGCCCGGCCTGG - Intergenic
992419540 5:76589029-76589051 ATGAGCCACCACGCCCGGCCAGG - Intronic
992820392 5:80490109-80490131 GTAAACCACCACGCCCGGCCAGG - Intronic
993169882 5:84404956-84404978 GTAAGCCACCATGCCCGGCCAGG + Intergenic
994779509 5:104071354-104071376 GCCCGACACCACGCCCGGCTAGG - Intergenic
995141553 5:108740908-108740930 GTAAGCCACCACGCCCTGCCTGG + Intergenic
995913548 5:117216095-117216117 GTAAGCCACCAGGCCCGGCCTGG - Intergenic
996069020 5:119113284-119113306 TCACGCCACCATACTCAGCCTGG - Intronic
996077140 5:119209392-119209414 TCACACCACTACACCCAGCCTGG - Intronic
997124076 5:131208412-131208434 ATGAGCCACCACGCCCGGCCTGG + Intergenic
997648043 5:135494188-135494210 GCACACCACCAAGCCCTGCCAGG + Intergenic
997990172 5:138538170-138538192 GTGAGCCACCACGCCCGGCCTGG + Intronic
998051087 5:139035929-139035951 GAGAGCCACCACGCCCGGCCAGG + Intronic
998435889 5:142108702-142108724 TCGCGCCGCCCTGCCCGGCCCGG - Exonic
998485445 5:142498018-142498040 GTGAGCCACCACGCCCGGCCTGG + Intergenic
998498980 5:142615502-142615524 GTAAGCCACCGCGCCCGGCCTGG + Intronic
998729503 5:145058639-145058661 ATGAGCCACCACGCCCGGCCTGG - Intergenic
1000595601 5:163211853-163211875 ACGAGCCACCATGCCCGGCCAGG + Intergenic
1001069272 5:168570098-168570120 GTAAGCCACCGCGCCCGGCCTGG - Intronic
1001147630 5:169198649-169198671 ATGAGCCACCACGCCCGGCCAGG - Intronic
1001421993 5:171594984-171595006 GTGAGCCACCACGCCCGGCCCGG - Intergenic
1001909480 5:175503718-175503740 GTGAGCCACCACGCCCGGCCAGG - Intronic
1001991077 5:176115730-176115752 ATAAGCCACCACGCCCAGCCAGG - Intronic
1002117498 5:176974766-176974788 TCACGCCAGCACACTCAGCCCGG + Intronic
1002225794 5:177722410-177722432 ATAAGCCACCACGCCCAGCCAGG + Intronic
1002268056 5:178048802-178048824 ATAAGCCACCACGCCCAGCCAGG - Intronic
1002336718 5:178484539-178484561 GTGAGCCACCACGCCCGGCCCGG - Intronic
1002487376 5:179548848-179548870 GTGAGCCACCACGCCCGGCCTGG - Intergenic
1002509194 5:179701885-179701907 GCCCACCACCACACCCGGCCCGG + Intronic
1002543516 5:179922589-179922611 ACAAACCACCACGCCCGGCTTGG + Intronic
1002562618 5:180092615-180092637 GTGAGCCACCACGCCCGGCCCGG - Intergenic
1002592804 5:180302945-180302967 GTGAGCCACCACGCCCGGCCTGG - Intronic
1002595820 5:180322067-180322089 GTGAGCCACCACGCCCGGCCTGG + Intronic
1002731796 5:181341370-181341392 GTGAGCCACCACGCCCGGCCAGG - Intergenic
1002752733 6:132707-132729 GTGAGCCACCACGCCCGGCCAGG + Intergenic
1003058802 6:2846382-2846404 GCAAGCCACCGCGCCTGGCCAGG + Intergenic
1003320880 6:5049948-5049970 ATAAGCCACCATGCCCGGCCTGG + Intergenic
1003499546 6:6693352-6693374 GTAAGCCACCACGCCTGGCCTGG - Intergenic
1003624987 6:7733186-7733208 TCACGCCACTGCGTCCGGCCAGG + Intronic
1003894817 6:10597435-10597457 ACTAGCCACCACGCCCGGCCAGG + Intronic
1004142672 6:13034297-13034319 GTGAGCCACCACGCCCGGCCAGG + Intronic
1004159409 6:13200426-13200448 ACGTGCCACCACACCCGGCCAGG + Intronic
1004360168 6:14963961-14963983 GTGAGCCACCACGCCCGGCCAGG - Intergenic
1004582356 6:16966291-16966313 ATAAGCCACCGCGCCCGGCCTGG + Intergenic
1004640616 6:17511734-17511756 GTAAGCCACCCCGCCCGGCCTGG + Intronic
1004935267 6:20501255-20501277 GTGAGCCACCACGCCCGGCCAGG - Intergenic
1005278591 6:24246106-24246128 ATAAGCCACCGCGCCCGGCCTGG + Intronic
1005495702 6:26385830-26385852 GTGCGCCACCACGCCCAGCCTGG + Intronic
1005579361 6:27218807-27218829 TCACGCCACCATGCCCAGGTTGG - Intergenic
1005649458 6:27873378-27873400 TAACGCCTCCACGCCGTGCCAGG + Exonic
1006491267 6:34390638-34390660 GTGAGCCACCACGCCCGGCCTGG + Intronic
1007774990 6:44219806-44219828 CCACCCCACCCCGCCCCGCCAGG - Intronic
1008681135 6:53873579-53873601 GCGAGCCACCATGCCCGGCCGGG + Intronic
1008872699 6:56290780-56290802 GTGAGCCACCACGCCCGGCCAGG + Intronic
1009484074 6:64198138-64198160 GCCCGCCACCACGGCCGGCCCGG + Intronic
1009699395 6:67156455-67156477 GCGAGCCACCGCGCCCGGCCAGG + Intergenic
1010135917 6:72552746-72552768 GTAAGCCACCACACCCGGCCGGG + Intergenic
1010238721 6:73597183-73597205 GTAAGCCACCACGCCTGGCCTGG - Intronic
1010344754 6:74798957-74798979 GTGAGCCACCACGCCCGGCCTGG - Intergenic
1010350513 6:74868423-74868445 GTGAGCCACCACGCCCGGCCGGG + Intergenic
1010928833 6:81776205-81776227 GTAAGCCACCACGCCAGGCCTGG - Intergenic
1011938181 6:92808740-92808762 ATGAGCCACCACGCCCGGCCAGG - Intergenic
1012224078 6:96685482-96685504 GTGAGCCACCACGCCCGGCCTGG + Intergenic
1012818769 6:104058322-104058344 ACACGCCACCATGCCCAGCTAGG - Intergenic
1013292361 6:108730316-108730338 TCAAGCCACCACGCTCGGCCAGG - Intergenic
1013399437 6:109778176-109778198 ATGAGCCACCACGCCCGGCCTGG - Intronic
1013521352 6:110936583-110936605 GTGAGCCACCACGCCCGGCCTGG + Intergenic
1013530342 6:111013852-111013874 TTGAGCCACCACGCCTGGCCTGG - Intronic
1013649021 6:112174771-112174793 ATGAGCCACCACGCCCGGCCTGG + Intronic
1013700779 6:112767119-112767141 ATGAGCCACCACGCCCGGCCAGG - Intergenic
1014119004 6:117701524-117701546 GTGAGCCACCACGCCCGGCCGGG + Intronic
1014121527 6:117730594-117730616 ATGAGCCACCACGCCCGGCCGGG + Intergenic
1014362175 6:120492803-120492825 ACATGCCACCACGCCCTGCTAGG + Intergenic
1015604496 6:134941352-134941374 GCATGCCACCACGCCCGGCTGGG + Intronic
1015687063 6:135876574-135876596 TTCAGCCACCACGCCCAGCCTGG - Intronic
1015838559 6:137450201-137450223 GTAAGCCACCACGCCCAGCCTGG + Intergenic
1015863187 6:137701819-137701841 TCAGGACAACAGGCCCGGCCTGG - Intergenic
1015865508 6:137722613-137722635 GTGAGCCACCACGCCCGGCCTGG + Intergenic
1016051508 6:139535316-139535338 GGGAGCCACCACGCCCGGCCTGG - Intergenic
1016340816 6:143060473-143060495 CCCCGCCCCCTCGCCCGGCCCGG + Intergenic
1016570975 6:145512430-145512452 GTGAGCCACCACGCCCGGCCTGG - Intronic
1016838853 6:148506049-148506071 GTGAGCCACCACGCCCGGCCTGG + Intronic
1017783575 6:157735406-157735428 ATGAGCCACCACGCCCGGCCAGG - Intronic
1017848314 6:158279222-158279244 TTGAGCCACCGCGCCCGGCCTGG + Intronic
1017932796 6:158974085-158974107 GTAAGCCACCACACCCGGCCAGG + Intronic
1018199947 6:161385208-161385230 ATAAGCCACCTCGCCCGGCCGGG + Intronic
1018632219 6:165831100-165831122 TTGAGCCACCGCGCCCGGCCTGG - Intronic
1019236048 6:170613683-170613705 GTGAGCCACCACGCCCGGCCAGG - Intergenic
1019463880 7:1175808-1175830 GTGAGCCACCACGCCCGGCCGGG + Intergenic
1019464314 7:1178584-1178606 ACACGCCACCACGCCTGGCTTGG - Intergenic
1019692607 7:2424921-2424943 GTGAGCCACCACGCCCGGCCTGG - Intronic
1019782479 7:2951781-2951803 GTAAGCCACCACGCCCAGCCAGG + Intronic
1019817633 7:3212746-3212768 CTGAGCCACCACGCCCGGCCAGG + Intergenic
1019992866 7:4704166-4704188 GTGCGCCACCACGCCCGGCCAGG - Intronic
1020245866 7:6429084-6429106 CTGAGCCACCACGCCCGGCCTGG + Intronic
1020408136 7:7860476-7860498 ATAAGCCACCACGCTCGGCCAGG - Intronic
1021066704 7:16184221-16184243 ATGAGCCACCACGCCCGGCCTGG + Intronic
1021124043 7:16830112-16830134 TTGAGCCACCACGCCCAGCCGGG - Intronic
1021363501 7:19746971-19746993 GTGAGCCACCACGCCCGGCCGGG - Intronic
1021682196 7:23144948-23144970 ACATGCCTCCACGCCCGGCTAGG - Intronic
1022004432 7:26254724-26254746 ATAAGCCACCACGCCCAGCCCGG + Intergenic
1023953020 7:44862503-44862525 GTAAGCCACCACGCCCAGCCTGG + Intergenic
1024021637 7:45376447-45376469 ACATGCCACCATGCCCAGCCTGG - Intergenic
1024321767 7:48078092-48078114 ACAAGCCACCACACCCAGCCAGG - Intergenic
1024578460 7:50782920-50782942 CCACGCCCCAACGCCCGGCGGGG + Intronic
1024637617 7:51303276-51303298 GTGAGCCACCACGCCCGGCCCGG - Intronic
1025057981 7:55780404-55780426 AGAAGCCACCGCGCCCGGCCGGG + Intergenic
1025090704 7:56061489-56061511 ACCTGCCACCACACCCGGCCAGG + Intronic
1025135482 7:56408269-56408291 GTGAGCCACCACGCCCGGCCTGG - Intergenic
1025289007 7:57695761-57695783 GTAAGCCACCACGCCTGGCCTGG + Intergenic
1025781444 7:64605262-64605284 GCGAGCCACCACGCCCGGCCCGG + Intergenic
1026114789 7:67487064-67487086 ATAAGCCACCACGCCTGGCCAGG + Intergenic
1026460396 7:70609707-70609729 GTGAGCCACCACGCCCGGCCAGG + Intronic
1026558832 7:71431253-71431275 TCACACCACTACACCCAGCCTGG - Intronic
1026810195 7:73457458-73457480 GTGAGCCACCACGCCCGGCCGGG + Intronic
1026830344 7:73606706-73606728 GTGAGCCACCACGCCCGGCCTGG + Intronic
1026964988 7:74433886-74433908 ATGAGCCACCACGCCCGGCCGGG + Intergenic
1027213981 7:76172472-76172494 GTAAGCCACCAAGCCCGGCCTGG - Intergenic
1027365400 7:77452419-77452441 ATAAGCCACCATGCCCGGCCTGG + Intergenic
1027548360 7:79558900-79558922 TTGAGCCACCATGCCCGGCCAGG + Intergenic
1028526994 7:91797587-91797609 GTGAGCCACCACGCCCGGCCAGG + Intronic
1029120567 7:98265169-98265191 ATGAGCCACCACGCCCGGCCAGG + Intronic
1029144692 7:98437349-98437371 GTAAGCCACCACGCCCAGCCAGG - Intergenic
1029192675 7:98782929-98782951 GTGAGCCACCACGCCCGGCCTGG + Intergenic
1029206738 7:98873829-98873851 ATAAGCCACCGCGCCCGGCCAGG + Intergenic
1029228680 7:99048103-99048125 TTGAGCCACCACGCCCGGCCTGG - Intronic
1029304786 7:99611051-99611073 ACGAGCCACCACGCCCAGCCCGG - Intergenic
1029543780 7:101199809-101199831 TTGAGCCACCGCGCCCGGCCTGG - Intronic
1029687297 7:102157495-102157517 ATAAGCCACCGCGCCCGGCCTGG - Intronic
1029716240 7:102328395-102328417 GTAAGCCACCACACCCGGCCAGG + Intergenic
1029722877 7:102381599-102381621 GTAAGCCACCACACCCGGCCAGG + Intronic
1029891813 7:103938036-103938058 ATGAGCCACCACGCCCGGCCAGG - Intronic
1030224158 7:107130215-107130237 ATGAGCCACCACGCCCGGCCCGG - Intronic
1030237797 7:107285711-107285733 CCATGCCACCAGGTCCGGCCGGG - Intronic
1030250691 7:107440969-107440991 ATGAGCCACCACGCCCGGCCTGG - Intronic
1030300155 7:107966489-107966511 GTAAGCCACCACGCCCAGCCAGG + Intronic
1030301166 7:107976359-107976381 TCCCACCACCACACCAGGCCAGG + Intronic
1030704607 7:112678498-112678520 GCCCGCCACCACGCCCGGCTAGG - Intergenic
1031060852 7:117049921-117049943 TTGAGCCACCAGGCCCGGCCAGG - Intronic
1031669967 7:124530203-124530225 GTGAGCCACCACGCCCGGCCTGG - Intergenic
1031710478 7:125039759-125039781 ACACACCACCATGCCCAGCCAGG + Intergenic
1031940637 7:127785189-127785211 GTAAGCCACCATGCCCGGCCAGG + Intronic
1032381138 7:131482609-131482631 TCACACCACCATGCCTGGCTAGG - Intronic
1032424649 7:131812669-131812691 ATGAGCCACCACGCCCGGCCAGG - Intergenic
1032573372 7:133025784-133025806 GTAAGCCACCACGCCTGGCCAGG + Intronic
1032677455 7:134144419-134144441 GTAAGCCACCACGCCTGGCCTGG + Intronic
1032678748 7:134159506-134159528 GCAAGCCACCACGCCCAGCCTGG - Intronic
1033101442 7:138476310-138476332 GTGAGCCACCACGCCCGGCCTGG - Intronic
1033146843 7:138878476-138878498 ATGAGCCACCACGCCCGGCCAGG - Intronic
1033203130 7:139391867-139391889 GTGAGCCACCACGCCCGGCCTGG + Intronic
1033217629 7:139505001-139505023 TCCAGCCACCATGCCTGGCCTGG - Intergenic
1033339675 7:140482115-140482137 GTGAGCCACCACGCCCGGCCTGG + Intergenic
1033357958 7:140616082-140616104 ATGAGCCACCACGCCCGGCCAGG - Intronic
1033686886 7:143648197-143648219 GTAAGCCACCATGCCCGGCCTGG + Intronic
1033688848 7:143719119-143719141 GTAAGCCACCATGCCCGGCCTGG - Intronic
1033697725 7:143809426-143809448 GTAAGCCACCATGCCCGGCCTGG - Intergenic
1033766119 7:144492295-144492317 ATGAGCCACCACGCCCGGCCTGG - Intronic
1033939812 7:146638765-146638787 TTGAGCCACCGCGCCCGGCCAGG + Intronic
1034323105 7:150203852-150203874 CCACCACACCACACCCGGCCCGG + Intergenic
1034510226 7:151527963-151527985 GCGAGCCACCACGCCTGGCCAGG + Intergenic
1034770076 7:153765252-153765274 CCACCACACCACACCCGGCCCGG - Intergenic
1035511721 8:192889-192911 GTGAGCCACCACGCCCGGCCAGG + Intronic
1035830206 8:2687378-2687400 TTAAGCCACCATGACCGGCCTGG + Intergenic
1036432170 8:8701865-8701887 TCGCGCCGCCCCGCCGGGCCAGG - Intergenic
1036660313 8:10703718-10703740 ACGAGCCACCACGCCTGGCCTGG - Intronic
1037247100 8:16847293-16847315 TCACGCCACCACACCAGGCCTGG + Intergenic
1037368115 8:18144515-18144537 GTGAGCCACCACGCCCGGCCCGG + Intergenic
1037796653 8:22001039-22001061 ATGAGCCACCACGCCCGGCCAGG - Intronic
1038187835 8:25291703-25291725 TTGAGCCACCACGCCTGGCCTGG - Intronic
1038606201 8:29007534-29007556 ACAAGCCACCATGCCCAGCCTGG - Intronic
1038726170 8:30084250-30084272 ATGAGCCACCACGCCCGGCCTGG - Intergenic
1038802610 8:30762911-30762933 TCACGCCACTGCACCCAGCCTGG - Intronic
1039045686 8:33447164-33447186 TTGAGCCACCGCGCCCGGCCTGG - Intronic
1039046238 8:33453013-33453035 AGAAGCCACCACGCCCGGCCAGG + Intronic
1040569743 8:48597135-48597157 ACATGCCACCACGCTTGGCCAGG + Intergenic
1041063797 8:54061629-54061651 GCACACCACCATGCCCCGCCAGG - Intronic
1041073304 8:54146161-54146183 TGAGGCCACTGCGCCCGGCCAGG - Intronic
1041265526 8:56060605-56060627 ACGTGCCACCACGCCCGGCCAGG - Intergenic
1041709811 8:60884158-60884180 TTGAGCCACCATGCCCGGCCGGG + Intergenic
1042199987 8:66272000-66272022 GTGAGCCACCACGCCCGGCCGGG + Intergenic
1042461385 8:69073215-69073237 GTGAGCCACCACGCCCGGCCAGG - Intergenic
1043464767 8:80493680-80493702 ATGCGCCACCACGCCCGGCTCGG - Intronic
1044112033 8:88286851-88286873 ATGAGCCACCACGCCCGGCCTGG + Intronic
1044667134 8:94642099-94642121 TCACGCCACCCACCCCAGCCTGG + Intronic
1044859171 8:96505580-96505602 ATAAGCCACCGCGCCCGGCCTGG + Intronic
1044886851 8:96788440-96788462 TTGAGCCACCATGCCCGGCCTGG + Intronic
1045457584 8:102396986-102397008 GTGAGCCACCACGCCCGGCCTGG + Intronic
1045589073 8:103573101-103573123 TCACACCACCACATCCAGCCTGG - Intronic
1045627465 8:104071716-104071738 ATGAGCCACCACGCCCGGCCGGG + Intronic
1046295141 8:112209424-112209446 TGAAGCCACCGCGCCCGGCCAGG - Intergenic
1046522627 8:115344763-115344785 ATGAGCCACCACGCCCGGCCCGG + Intergenic
1046774658 8:118151544-118151566 GTGAGCCACCACGCCCGGCCTGG - Intergenic
1047212363 8:122850340-122850362 TCAAGACACCACTACCGGCCGGG + Intronic
1047476337 8:125234966-125234988 TTGAGCCACCACGCCTGGCCAGG - Intronic
1047502227 8:125451100-125451122 GTGAGCCACCACGCCCGGCCAGG + Intergenic
1048073176 8:131041622-131041644 TCCCTCCGCCACCCCCGGCCCGG - Exonic
1048281419 8:133108266-133108288 GTGAGCCACCACGCCCGGCCTGG + Intronic
1048629085 8:136221139-136221161 CTAAGCCATCACGCCCGGCCTGG - Intergenic
1049690392 8:143956228-143956250 ATAAGCCACCACGCCCGGCCAGG + Intronic
1050249381 9:3728650-3728672 GTAAGCCACCACTCCCGGCCAGG - Intergenic
1051171534 9:14322587-14322609 CCACCCTACCACGGCCGGCCTGG + Intronic
1051259215 9:15245969-15245991 GTGAGCCACCACGCCCGGCCTGG - Intronic
1051305404 9:15703186-15703208 CTGAGCCACCACGCCCGGCCGGG + Intronic
1051754023 9:20375754-20375776 ACCTGCCACCACGCCCGGCTAGG + Intronic
1051999519 9:23260202-23260224 GTGAGCCACCACGCCCGGCCTGG - Intergenic
1052193002 9:25679518-25679540 GTGAGCCACCACGCCCGGCCTGG - Intergenic
1052436491 9:28436737-28436759 ATAAGCCACCGCGCCCGGCCAGG + Intronic
1052918944 9:33947537-33947559 GTGAGCCACCACGCCCGGCCTGG - Intronic
1052925022 9:34008168-34008190 ATGCGCCACCATGCCCGGCCCGG - Intronic
1053154245 9:35764072-35764094 TCATGCCACCACACTCAGCCTGG + Intergenic
1053182748 9:35987619-35987641 GCACGCCACCACGCCCAGCCGGG - Intergenic
1053333050 9:37234149-37234171 ATCAGCCACCACGCCCGGCCAGG + Intronic
1054783065 9:69183995-69184017 GCGAGCCACCACGCCCAGCCAGG + Intronic
1055300908 9:74881010-74881032 GCAAGCTACCACGCCCAGCCAGG - Intronic
1056215438 9:84402085-84402107 GTAAGCCACCACACCCGGCCTGG + Intergenic
1056224129 9:84478882-84478904 CTGAGCCACCACGCCCGGCCAGG + Intergenic
1056288977 9:85122697-85122719 GTGAGCCACCACGCCCGGCCAGG - Intergenic
1056349861 9:85739424-85739446 GTCCGCCACCACGCCCGTCCTGG - Intronic
1056783211 9:89567123-89567145 GTAAGCCACCATGCCCGGCCAGG + Intergenic
1056810676 9:89761531-89761553 GTAAGCCACCATGCCCGGCCAGG + Intergenic
1057057509 9:91975100-91975122 ATGAGCCACCACGCCCGGCCGGG - Intergenic
1057339708 9:94188981-94189003 GTGAGCCACCACGCCCGGCCTGG - Intergenic
1057543497 9:95999076-95999098 GTGAGCCACCACGCCCGGCCAGG - Intronic
1057636752 9:96776490-96776512 GTGAGCCACCACGCCCGGCCTGG - Intronic
1058021474 9:100094373-100094395 ATGAGCCACCACGCCCGGCCTGG - Intronic
1058278708 9:103083846-103083868 GTAAGCCACCACGCCCTGCCTGG - Intergenic
1059043384 9:110839013-110839035 CACGGCCACCACGCCCGGCCTGG - Intergenic
1059207221 9:112477977-112477999 GTAAGCCACCATGCCCGGCCAGG + Intronic
1060080290 9:120637509-120637531 ATGAGCCACCACGCCCGGCCTGG - Intronic
1060084566 9:120685114-120685136 GTAAGCCACCACACCCGGCCGGG + Intronic
1060696253 9:125711350-125711372 AGGAGCCACCACGCCCGGCCCGG - Intergenic
1060971774 9:127742517-127742539 TCGAGCCACCGCGCCCGGCCAGG + Intronic
1061027869 9:128062270-128062292 TTGAGCCACCTCGCCCGGCCAGG + Exonic
1061058109 9:128235211-128235233 ATGAGCCACCACGCCCGGCCAGG - Intronic
1061086452 9:128401929-128401951 ACAAGCCACCGTGCCCGGCCTGG - Intergenic
1061097986 9:128471194-128471216 GTGAGCCACCACGCCCGGCCGGG + Intronic
1061320814 9:129828073-129828095 AGGAGCCACCACGCCCGGCCAGG + Exonic
1061353406 9:130084493-130084515 GCAAGCCACCATGCCCAGCCAGG - Intronic
1061439381 9:130589856-130589878 TCACGCCACCACACTCAGCTAGG + Intronic
1061538138 9:131261942-131261964 GTGAGCCACCACGCCCGGCCAGG - Intronic
1061578339 9:131521852-131521874 GTAAGCCACCGCGCCCGGCCTGG - Intronic
1061966562 9:134017700-134017722 GTGAGCCACCACGCCCGGCCAGG - Intergenic
1062007176 9:134245458-134245480 ACAAGCCACCGCGCCCGGCCAGG - Intergenic
1062036702 9:134385676-134385698 CCAGGCCACCACTCCAGGCCAGG + Intronic
1062245656 9:135564784-135564806 GTGAGCCACCACGCCCGGCCAGG + Intronic
1062369422 9:136229996-136230018 GTGAGCCACCACGCCCGGCCAGG - Intronic
1062409979 9:136418699-136418721 TCAGGCCACCAGGCCAGGCCAGG + Intronic
1062417085 9:136456883-136456905 GTGAGCCACCACGCCCGGCCAGG - Intronic
1062430485 9:136524916-136524938 GTAAGCCACCGCGCCCGGCCAGG + Intronic
1062585375 9:137247001-137247023 TTAAGCCACCACGCCCGGCCAGG - Intronic
1203611543 Un_KI270749v1:11192-11214 ATAAGCCACCACGCCCGGCCTGG - Intergenic
1185447612 X:267795-267817 GTGAGCCACCACGCCCGGCCCGG + Intergenic
1185587614 X:1252216-1252238 TTGAGCCACCACTCCCGGCCTGG + Intergenic
1185785583 X:2888243-2888265 GCACACCACCACGCCTGGCTAGG - Intergenic
1185789858 X:2920516-2920538 GTGCGCCACCACGCCTGGCCTGG + Intronic
1186200654 X:7152232-7152254 GTGAGCCACCACGCCCGGCCAGG + Intergenic
1186551479 X:10510548-10510570 GTGAGCCACCACGCCCGGCCTGG - Intronic
1187162214 X:16775258-16775280 ATGAGCCACCACGCCCGGCCAGG - Intergenic
1187168405 X:16826944-16826966 ATAAGCCACCATGCCCGGCCGGG - Intronic
1187417000 X:19102195-19102217 GTGAGCCACCACGCCCGGCCTGG + Intronic
1187445104 X:19354211-19354233 GTGAGCCACCACGCCCGGCCAGG + Intronic
1187773080 X:22723808-22723830 ATAAGCCACCACGCTCGGCCTGG + Intergenic
1187944103 X:24409812-24409834 ATGAGCCACCACGCCCGGCCAGG - Intergenic
1188245086 X:27829610-27829632 TCACGCCACTGCACCCAGCCTGG + Intergenic
1188295765 X:28446232-28446254 ATGAGCCACCACGCCCGGCCTGG - Intergenic
1189689706 X:43603160-43603182 TCACACCACCACACCTGGCTAGG - Intergenic
1189797273 X:44657294-44657316 TTGAGCCACCACGCCCGGTCTGG - Intergenic
1189815987 X:44824406-44824428 TTGAGCCACCATGCCCGGCCGGG + Intergenic
1189852429 X:45190991-45191013 GTGAGCCACCACGCCCGGCCAGG - Intronic
1189994585 X:46626555-46626577 GTGAGCCACCACGCCCGGCCTGG + Intronic
1190229646 X:48572320-48572342 GTGAGCCACCACGCCCGGCCTGG - Intergenic
1190378310 X:49813114-49813136 ATAAGCCACCATGCCCGGCCTGG - Intergenic
1190748319 X:53340066-53340088 GTGAGCCACCACGCCCGGCCGGG - Intergenic
1190755493 X:53397901-53397923 GTGAGCCACCACGCCCGGCCTGG - Intronic
1190957717 X:55211912-55211934 ATAAGCCACCACGCCCGGCCTGG - Intronic
1191856582 X:65631967-65631989 CCACCCCACCATGCCCAGCCTGG + Intronic
1192172470 X:68865489-68865511 TCACACCAACAGGCCCAGCCTGG - Intergenic
1192372764 X:70528606-70528628 ACAAGCCACTACGCCTGGCCTGG + Intergenic
1192416018 X:70981411-70981433 GCATGCCACCACGTCTGGCCAGG - Intergenic
1192577002 X:72251020-72251042 ATGAGCCACCACGCCCGGCCTGG + Intronic
1192746929 X:73948434-73948456 TTGAGCCACCGCGCCCGGCCGGG + Intergenic
1192756498 X:74051397-74051419 TTGAGCCACCATGCCCGGCCCGG - Intergenic
1192993759 X:76490178-76490200 GTGAGCCACCACGCCCGGCCTGG + Intergenic
1193121836 X:77831297-77831319 TTGAGCCACCATGCCCGGCCTGG + Intronic
1194325773 X:92514763-92514785 GTGAGCCACCACGCCCGGCCGGG - Intronic
1194679415 X:96833942-96833964 AGCCACCACCACGCCCGGCCAGG + Intronic
1195234849 X:102887282-102887304 ATAAGCCACCACGCCTGGCCAGG + Intergenic
1195930653 X:110072016-110072038 ACCCACCACCACGCCCAGCCAGG - Intronic
1196840529 X:119855014-119855036 GTGAGCCACCACGCCCGGCCTGG - Intergenic
1196951973 X:120932589-120932611 ACATGCCACCACGCCTGGCTAGG + Intergenic
1196952657 X:120937450-120937472 ACATGCCACCACGCCTGGCTAGG + Intergenic
1196953342 X:120942311-120942333 ACATGCCACCACGCCTGGCTAGG + Intergenic
1196954027 X:120947171-120947193 ACATGCCACCACGCCTGGCTAGG + Intronic
1196954712 X:120952032-120952054 ACATGCCACCACGCCTGGCTAGG + Intronic
1196956082 X:120961775-120961797 ACATGCCACCACGCCTGGCTAGG + Intergenic
1196956764 X:120966636-120966658 ACATGCCACCACGCCTGGCTAGG + Intergenic
1196957446 X:120971496-120971518 ACATGCCACCACGCCTGGCTAGG + Intergenic
1196958128 X:120976356-120976378 ACATGCCACCACGCCTGGCTAGG + Intergenic
1196958810 X:120981216-120981238 ACATGCCACCACGCCTGGCTAGG + Intergenic
1196959491 X:120986076-120986098 ACATGCCACCACGCCTGGCTAGG + Intergenic
1197035798 X:121871293-121871315 TCCGGCCACCGCGCACGGCCAGG - Intergenic
1197203757 X:123772165-123772187 TTGAGCCACCGCGCCCGGCCAGG - Intergenic
1197247183 X:124178315-124178337 ATAAGCCACCACGCCTGGCCTGG - Intronic
1197618615 X:128721599-128721621 GTGAGCCACCACGCCCGGCCCGG + Intergenic
1198229438 X:134675381-134675403 GTGAGCCACCACGCCCGGCCAGG - Intronic
1198253549 X:134905219-134905241 GCCCGCCACCACGCCTGGCGTGG - Intronic
1198259686 X:134954693-134954715 TTGAGCCACCGCGCCCGGCCAGG + Intergenic
1198383803 X:136108391-136108413 ATGAGCCACCACGCCCGGCCTGG + Intergenic
1198470977 X:136946749-136946771 GTCAGCCACCACGCCCGGCCTGG - Intergenic
1198478355 X:137017439-137017461 TTGTGCCACCATGCCCGGCCAGG + Intergenic
1199434878 X:147802183-147802205 GTGCGCCACCACTCCCGGCCGGG - Intergenic
1200114471 X:153764178-153764200 TCATCCCAACAAGCCCGGCCAGG - Exonic
1200185560 X:154180894-154180916 GTGAGCCACCACGCCCGGCCCGG - Intergenic
1200202619 X:154292954-154292976 GTGAGCCACCACGCCCGGCCCGG - Intronic
1200207547 X:154328259-154328281 GTAAGCCACCACGCCTGGCCTGG - Intronic
1200612352 Y:5339498-5339520 CCCCGCCACCAAGCCCGGCTAGG + Intronic
1200634501 Y:5633930-5633952 GTGAGCCACCACGCCCGGCCAGG - Intronic
1201797482 Y:17913869-17913891 ACAGGCCACCGCGCCCGGCCAGG - Intergenic
1201804071 Y:17992090-17992112 ACAGGCCACCGCGCCCGGCCAGG + Intergenic