ID: 1168212760

View in Genome Browser
Species Human (GRCh38)
Location 19:54902705-54902727
Sequence TGGAGGAGACTTATGTAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168212760_1168212768 5 Left 1168212760 19:54902705-54902727 CCAGCCTACATAAGTCTCCTCCA No data
Right 1168212768 19:54902733-54902755 GGCATCCAAGCGCTCCGTAGGGG No data
1168212760_1168212769 6 Left 1168212760 19:54902705-54902727 CCAGCCTACATAAGTCTCCTCCA No data
Right 1168212769 19:54902734-54902756 GCATCCAAGCGCTCCGTAGGGGG No data
1168212760_1168212771 10 Left 1168212760 19:54902705-54902727 CCAGCCTACATAAGTCTCCTCCA No data
Right 1168212771 19:54902738-54902760 CCAAGCGCTCCGTAGGGGGAAGG No data
1168212760_1168212766 3 Left 1168212760 19:54902705-54902727 CCAGCCTACATAAGTCTCCTCCA No data
Right 1168212766 19:54902731-54902753 AGGGCATCCAAGCGCTCCGTAGG No data
1168212760_1168212767 4 Left 1168212760 19:54902705-54902727 CCAGCCTACATAAGTCTCCTCCA No data
Right 1168212767 19:54902732-54902754 GGGCATCCAAGCGCTCCGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168212760 Original CRISPR TGGAGGAGACTTATGTAGGC TGG (reversed) Intergenic
No off target data available for this crispr