ID: 1168212764

View in Genome Browser
Species Human (GRCh38)
Location 19:54902722-54902744
Sequence CGCTTGGATGCCCTCTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168212764_1168212771 -7 Left 1168212764 19:54902722-54902744 CCTCCATAGAGGGCATCCAAGCG No data
Right 1168212771 19:54902738-54902760 CCAAGCGCTCCGTAGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168212764 Original CRISPR CGCTTGGATGCCCTCTATGG AGG (reversed) Intergenic
No off target data available for this crispr