ID: 1168212770

View in Genome Browser
Species Human (GRCh38)
Location 19:54902738-54902760
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168212770_1168212775 15 Left 1168212770 19:54902738-54902760 CCAAGCGCTCCGTAGGGGGAAGG No data
Right 1168212775 19:54902776-54902798 AGAGTTATGACAGCTGTGTAAGG No data
1168212770_1168212777 17 Left 1168212770 19:54902738-54902760 CCAAGCGCTCCGTAGGGGGAAGG No data
Right 1168212777 19:54902778-54902800 AGTTATGACAGCTGTGTAAGGGG No data
1168212770_1168212776 16 Left 1168212770 19:54902738-54902760 CCAAGCGCTCCGTAGGGGGAAGG No data
Right 1168212776 19:54902777-54902799 GAGTTATGACAGCTGTGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168212770 Original CRISPR CCTTCCCCCTACGGAGCGCT TGG (reversed) Intergenic
No off target data available for this crispr