ID: 1168212771

View in Genome Browser
Species Human (GRCh38)
Location 19:54902738-54902760
Sequence CCAAGCGCTCCGTAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168212761_1168212771 6 Left 1168212761 19:54902709-54902731 CCTACATAAGTCTCCTCCATAGA No data
Right 1168212771 19:54902738-54902760 CCAAGCGCTCCGTAGGGGGAAGG No data
1168212760_1168212771 10 Left 1168212760 19:54902705-54902727 CCAGCCTACATAAGTCTCCTCCA No data
Right 1168212771 19:54902738-54902760 CCAAGCGCTCCGTAGGGGGAAGG No data
1168212764_1168212771 -7 Left 1168212764 19:54902722-54902744 CCTCCATAGAGGGCATCCAAGCG No data
Right 1168212771 19:54902738-54902760 CCAAGCGCTCCGTAGGGGGAAGG No data
1168212765_1168212771 -10 Left 1168212765 19:54902725-54902747 CCATAGAGGGCATCCAAGCGCTC No data
Right 1168212771 19:54902738-54902760 CCAAGCGCTCCGTAGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168212771 Original CRISPR CCAAGCGCTCCGTAGGGGGA AGG Intergenic
No off target data available for this crispr