ID: 1168212776

View in Genome Browser
Species Human (GRCh38)
Location 19:54902777-54902799
Sequence GAGTTATGACAGCTGTGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168212772_1168212776 7 Left 1168212772 19:54902747-54902769 CCGTAGGGGGAAGGATAAAGAAA No data
Right 1168212776 19:54902777-54902799 GAGTTATGACAGCTGTGTAAGGG No data
1168212765_1168212776 29 Left 1168212765 19:54902725-54902747 CCATAGAGGGCATCCAAGCGCTC No data
Right 1168212776 19:54902777-54902799 GAGTTATGACAGCTGTGTAAGGG No data
1168212770_1168212776 16 Left 1168212770 19:54902738-54902760 CCAAGCGCTCCGTAGGGGGAAGG No data
Right 1168212776 19:54902777-54902799 GAGTTATGACAGCTGTGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168212776 Original CRISPR GAGTTATGACAGCTGTGTAA GGG Intergenic
No off target data available for this crispr