ID: 1168212777

View in Genome Browser
Species Human (GRCh38)
Location 19:54902778-54902800
Sequence AGTTATGACAGCTGTGTAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168212772_1168212777 8 Left 1168212772 19:54902747-54902769 CCGTAGGGGGAAGGATAAAGAAA No data
Right 1168212777 19:54902778-54902800 AGTTATGACAGCTGTGTAAGGGG No data
1168212765_1168212777 30 Left 1168212765 19:54902725-54902747 CCATAGAGGGCATCCAAGCGCTC No data
Right 1168212777 19:54902778-54902800 AGTTATGACAGCTGTGTAAGGGG No data
1168212770_1168212777 17 Left 1168212770 19:54902738-54902760 CCAAGCGCTCCGTAGGGGGAAGG No data
Right 1168212777 19:54902778-54902800 AGTTATGACAGCTGTGTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168212777 Original CRISPR AGTTATGACAGCTGTGTAAG GGG Intergenic
No off target data available for this crispr