ID: 1168217367

View in Genome Browser
Species Human (GRCh38)
Location 19:54936185-54936207
Sequence TGCTGGGGGATCTAGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 215}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168217367_1168217376 5 Left 1168217367 19:54936185-54936207 CCTTTTTCCTAGATCCCCCAGCA 0: 1
1: 0
2: 2
3: 23
4: 215
Right 1168217376 19:54936213-54936235 GTGCAGTGGACTCCAGGTGCTGG 0: 1
1: 0
2: 1
3: 10
4: 178
1168217367_1168217375 -1 Left 1168217367 19:54936185-54936207 CCTTTTTCCTAGATCCCCCAGCA 0: 1
1: 0
2: 2
3: 23
4: 215
Right 1168217375 19:54936207-54936229 AACACGGTGCAGTGGACTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 65
1168217367_1168217371 -9 Left 1168217367 19:54936185-54936207 CCTTTTTCCTAGATCCCCCAGCA 0: 1
1: 0
2: 2
3: 23
4: 215
Right 1168217371 19:54936199-54936221 CCCCCAGCAACACGGTGCAGTGG 0: 1
1: 0
2: 0
3: 5
4: 131
1168217367_1168217377 6 Left 1168217367 19:54936185-54936207 CCTTTTTCCTAGATCCCCCAGCA 0: 1
1: 0
2: 2
3: 23
4: 215
Right 1168217377 19:54936214-54936236 TGCAGTGGACTCCAGGTGCTGGG 0: 1
1: 0
2: 1
3: 24
4: 180
1168217367_1168217378 7 Left 1168217367 19:54936185-54936207 CCTTTTTCCTAGATCCCCCAGCA 0: 1
1: 0
2: 2
3: 23
4: 215
Right 1168217378 19:54936215-54936237 GCAGTGGACTCCAGGTGCTGGGG 0: 1
1: 0
2: 1
3: 28
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168217367 Original CRISPR TGCTGGGGGATCTAGGAAAA AGG (reversed) Intronic