ID: 1168217369

View in Genome Browser
Species Human (GRCh38)
Location 19:54936192-54936214
Sequence ACCGTGTTGCTGGGGGATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168217369_1168217381 29 Left 1168217369 19:54936192-54936214 CCTAGATCCCCCAGCAACACGGT 0: 1
1: 0
2: 1
3: 20
4: 118
Right 1168217381 19:54936244-54936266 GTGACCGTGAGACCCACCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 89
1168217369_1168217377 -1 Left 1168217369 19:54936192-54936214 CCTAGATCCCCCAGCAACACGGT 0: 1
1: 0
2: 1
3: 20
4: 118
Right 1168217377 19:54936214-54936236 TGCAGTGGACTCCAGGTGCTGGG 0: 1
1: 0
2: 1
3: 24
4: 180
1168217369_1168217378 0 Left 1168217369 19:54936192-54936214 CCTAGATCCCCCAGCAACACGGT 0: 1
1: 0
2: 1
3: 20
4: 118
Right 1168217378 19:54936215-54936237 GCAGTGGACTCCAGGTGCTGGGG 0: 1
1: 0
2: 1
3: 28
4: 336
1168217369_1168217376 -2 Left 1168217369 19:54936192-54936214 CCTAGATCCCCCAGCAACACGGT 0: 1
1: 0
2: 1
3: 20
4: 118
Right 1168217376 19:54936213-54936235 GTGCAGTGGACTCCAGGTGCTGG 0: 1
1: 0
2: 1
3: 10
4: 178
1168217369_1168217375 -8 Left 1168217369 19:54936192-54936214 CCTAGATCCCCCAGCAACACGGT 0: 1
1: 0
2: 1
3: 20
4: 118
Right 1168217375 19:54936207-54936229 AACACGGTGCAGTGGACTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168217369 Original CRISPR ACCGTGTTGCTGGGGGATCT AGG (reversed) Intronic