ID: 1168217370

View in Genome Browser
Species Human (GRCh38)
Location 19:54936199-54936221
Sequence CCACTGCACCGTGTTGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168217370_1168217376 -9 Left 1168217370 19:54936199-54936221 CCCCCAGCAACACGGTGCAGTGG 0: 1
1: 0
2: 1
3: 10
4: 111
Right 1168217376 19:54936213-54936235 GTGCAGTGGACTCCAGGTGCTGG 0: 1
1: 0
2: 1
3: 10
4: 178
1168217370_1168217377 -8 Left 1168217370 19:54936199-54936221 CCCCCAGCAACACGGTGCAGTGG 0: 1
1: 0
2: 1
3: 10
4: 111
Right 1168217377 19:54936214-54936236 TGCAGTGGACTCCAGGTGCTGGG 0: 1
1: 0
2: 1
3: 24
4: 180
1168217370_1168217381 22 Left 1168217370 19:54936199-54936221 CCCCCAGCAACACGGTGCAGTGG 0: 1
1: 0
2: 1
3: 10
4: 111
Right 1168217381 19:54936244-54936266 GTGACCGTGAGACCCACCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 89
1168217370_1168217378 -7 Left 1168217370 19:54936199-54936221 CCCCCAGCAACACGGTGCAGTGG 0: 1
1: 0
2: 1
3: 10
4: 111
Right 1168217378 19:54936215-54936237 GCAGTGGACTCCAGGTGCTGGGG 0: 1
1: 0
2: 1
3: 28
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168217370 Original CRISPR CCACTGCACCGTGTTGCTGG GGG (reversed) Intronic