ID: 1168217372

View in Genome Browser
Species Human (GRCh38)
Location 19:54936200-54936222
Sequence TCCACTGCACCGTGTTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168217372_1168217383 30 Left 1168217372 19:54936200-54936222 CCCCAGCAACACGGTGCAGTGGA 0: 1
1: 0
2: 0
3: 6
4: 120
Right 1168217383 19:54936253-54936275 AGACCCACCTCAGGTACTGCAGG 0: 1
1: 0
2: 0
3: 17
4: 115
1168217372_1168217378 -8 Left 1168217372 19:54936200-54936222 CCCCAGCAACACGGTGCAGTGGA 0: 1
1: 0
2: 0
3: 6
4: 120
Right 1168217378 19:54936215-54936237 GCAGTGGACTCCAGGTGCTGGGG 0: 1
1: 0
2: 1
3: 28
4: 336
1168217372_1168217377 -9 Left 1168217372 19:54936200-54936222 CCCCAGCAACACGGTGCAGTGGA 0: 1
1: 0
2: 0
3: 6
4: 120
Right 1168217377 19:54936214-54936236 TGCAGTGGACTCCAGGTGCTGGG 0: 1
1: 0
2: 1
3: 24
4: 180
1168217372_1168217381 21 Left 1168217372 19:54936200-54936222 CCCCAGCAACACGGTGCAGTGGA 0: 1
1: 0
2: 0
3: 6
4: 120
Right 1168217381 19:54936244-54936266 GTGACCGTGAGACCCACCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 89
1168217372_1168217376 -10 Left 1168217372 19:54936200-54936222 CCCCAGCAACACGGTGCAGTGGA 0: 1
1: 0
2: 0
3: 6
4: 120
Right 1168217376 19:54936213-54936235 GTGCAGTGGACTCCAGGTGCTGG 0: 1
1: 0
2: 1
3: 10
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168217372 Original CRISPR TCCACTGCACCGTGTTGCTG GGG (reversed) Intronic