ID: 1168217373

View in Genome Browser
Species Human (GRCh38)
Location 19:54936201-54936223
Sequence GTCCACTGCACCGTGTTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 60}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168217373_1168217383 29 Left 1168217373 19:54936201-54936223 CCCAGCAACACGGTGCAGTGGAC 0: 1
1: 0
2: 1
3: 6
4: 60
Right 1168217383 19:54936253-54936275 AGACCCACCTCAGGTACTGCAGG 0: 1
1: 0
2: 0
3: 17
4: 115
1168217373_1168217378 -9 Left 1168217373 19:54936201-54936223 CCCAGCAACACGGTGCAGTGGAC 0: 1
1: 0
2: 1
3: 6
4: 60
Right 1168217378 19:54936215-54936237 GCAGTGGACTCCAGGTGCTGGGG 0: 1
1: 0
2: 1
3: 28
4: 336
1168217373_1168217377 -10 Left 1168217373 19:54936201-54936223 CCCAGCAACACGGTGCAGTGGAC 0: 1
1: 0
2: 1
3: 6
4: 60
Right 1168217377 19:54936214-54936236 TGCAGTGGACTCCAGGTGCTGGG 0: 1
1: 0
2: 1
3: 24
4: 180
1168217373_1168217381 20 Left 1168217373 19:54936201-54936223 CCCAGCAACACGGTGCAGTGGAC 0: 1
1: 0
2: 1
3: 6
4: 60
Right 1168217381 19:54936244-54936266 GTGACCGTGAGACCCACCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168217373 Original CRISPR GTCCACTGCACCGTGTTGCT GGG (reversed) Intronic