ID: 1168217375

View in Genome Browser
Species Human (GRCh38)
Location 19:54936207-54936229
Sequence AACACGGTGCAGTGGACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 65}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168217364_1168217375 29 Left 1168217364 19:54936155-54936177 CCTGTCTGGGACGGCATCTGGAG 0: 1
1: 0
2: 0
3: 10
4: 86
Right 1168217375 19:54936207-54936229 AACACGGTGCAGTGGACTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 65
1168217366_1168217375 0 Left 1168217366 19:54936184-54936206 CCCTTTTTCCTAGATCCCCCAGC 0: 1
1: 0
2: 1
3: 14
4: 212
Right 1168217375 19:54936207-54936229 AACACGGTGCAGTGGACTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 65
1168217369_1168217375 -8 Left 1168217369 19:54936192-54936214 CCTAGATCCCCCAGCAACACGGT 0: 1
1: 0
2: 1
3: 20
4: 118
Right 1168217375 19:54936207-54936229 AACACGGTGCAGTGGACTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 65
1168217367_1168217375 -1 Left 1168217367 19:54936185-54936207 CCTTTTTCCTAGATCCCCCAGCA 0: 1
1: 0
2: 2
3: 23
4: 215
Right 1168217375 19:54936207-54936229 AACACGGTGCAGTGGACTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 65
1168217363_1168217375 30 Left 1168217363 19:54936154-54936176 CCCTGTCTGGGACGGCATCTGGA 0: 1
1: 0
2: 0
3: 12
4: 109
Right 1168217375 19:54936207-54936229 AACACGGTGCAGTGGACTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168217375 Original CRISPR AACACGGTGCAGTGGACTCC AGG Intronic