ID: 1168217377

View in Genome Browser
Species Human (GRCh38)
Location 19:54936214-54936236
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 180}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168217366_1168217377 7 Left 1168217366 19:54936184-54936206 CCCTTTTTCCTAGATCCCCCAGC 0: 1
1: 0
2: 1
3: 14
4: 212
Right 1168217377 19:54936214-54936236 TGCAGTGGACTCCAGGTGCTGGG 0: 1
1: 0
2: 1
3: 24
4: 180
1168217369_1168217377 -1 Left 1168217369 19:54936192-54936214 CCTAGATCCCCCAGCAACACGGT 0: 1
1: 0
2: 1
3: 20
4: 118
Right 1168217377 19:54936214-54936236 TGCAGTGGACTCCAGGTGCTGGG 0: 1
1: 0
2: 1
3: 24
4: 180
1168217373_1168217377 -10 Left 1168217373 19:54936201-54936223 CCCAGCAACACGGTGCAGTGGAC 0: 1
1: 0
2: 1
3: 6
4: 60
Right 1168217377 19:54936214-54936236 TGCAGTGGACTCCAGGTGCTGGG 0: 1
1: 0
2: 1
3: 24
4: 180
1168217367_1168217377 6 Left 1168217367 19:54936185-54936207 CCTTTTTCCTAGATCCCCCAGCA 0: 1
1: 0
2: 2
3: 23
4: 215
Right 1168217377 19:54936214-54936236 TGCAGTGGACTCCAGGTGCTGGG 0: 1
1: 0
2: 1
3: 24
4: 180
1168217370_1168217377 -8 Left 1168217370 19:54936199-54936221 CCCCCAGCAACACGGTGCAGTGG 0: 1
1: 0
2: 1
3: 10
4: 111
Right 1168217377 19:54936214-54936236 TGCAGTGGACTCCAGGTGCTGGG 0: 1
1: 0
2: 1
3: 24
4: 180
1168217372_1168217377 -9 Left 1168217372 19:54936200-54936222 CCCCAGCAACACGGTGCAGTGGA 0: 1
1: 0
2: 0
3: 6
4: 120
Right 1168217377 19:54936214-54936236 TGCAGTGGACTCCAGGTGCTGGG 0: 1
1: 0
2: 1
3: 24
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type