ID: 1168217381

View in Genome Browser
Species Human (GRCh38)
Location 19:54936244-54936266
Sequence GTGACCGTGAGACCCACCTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 89}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168217372_1168217381 21 Left 1168217372 19:54936200-54936222 CCCCAGCAACACGGTGCAGTGGA 0: 1
1: 0
2: 0
3: 6
4: 120
Right 1168217381 19:54936244-54936266 GTGACCGTGAGACCCACCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 89
1168217369_1168217381 29 Left 1168217369 19:54936192-54936214 CCTAGATCCCCCAGCAACACGGT 0: 1
1: 0
2: 1
3: 20
4: 118
Right 1168217381 19:54936244-54936266 GTGACCGTGAGACCCACCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 89
1168217374_1168217381 19 Left 1168217374 19:54936202-54936224 CCAGCAACACGGTGCAGTGGACT 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1168217381 19:54936244-54936266 GTGACCGTGAGACCCACCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 89
1168217379_1168217381 -4 Left 1168217379 19:54936225-54936247 CCAGGTGCTGGGGAGAGCCGTGA 0: 1
1: 0
2: 3
3: 23
4: 314
Right 1168217381 19:54936244-54936266 GTGACCGTGAGACCCACCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 89
1168217370_1168217381 22 Left 1168217370 19:54936199-54936221 CCCCCAGCAACACGGTGCAGTGG 0: 1
1: 0
2: 1
3: 10
4: 111
Right 1168217381 19:54936244-54936266 GTGACCGTGAGACCCACCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 89
1168217373_1168217381 20 Left 1168217373 19:54936201-54936223 CCCAGCAACACGGTGCAGTGGAC 0: 1
1: 0
2: 1
3: 6
4: 60
Right 1168217381 19:54936244-54936266 GTGACCGTGAGACCCACCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168217381 Original CRISPR GTGACCGTGAGACCCACCTC AGG Exonic