ID: 1168217878

View in Genome Browser
Species Human (GRCh38)
Location 19:54939680-54939702
Sequence CTGAAGCTGCAGATGGAGAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 613
Summary {0: 2, 1: 1, 2: 3, 3: 58, 4: 549}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168217878_1168217889 30 Left 1168217878 19:54939680-54939702 CCCTTCTCCATCTGCAGCTTCAG 0: 2
1: 1
2: 3
3: 58
4: 549
Right 1168217889 19:54939733-54939755 GGCCGAGCCCAGCTGGAACAGGG 0: 2
1: 0
2: 0
3: 15
4: 174
1168217878_1168217883 8 Left 1168217878 19:54939680-54939702 CCCTTCTCCATCTGCAGCTTCAG 0: 2
1: 1
2: 3
3: 58
4: 549
Right 1168217883 19:54939711-54939733 ACACAATCCAGCACACCGCGGGG 0: 1
1: 1
2: 0
3: 9
4: 38
1168217878_1168217882 7 Left 1168217878 19:54939680-54939702 CCCTTCTCCATCTGCAGCTTCAG 0: 2
1: 1
2: 3
3: 58
4: 549
Right 1168217882 19:54939710-54939732 CACACAATCCAGCACACCGCGGG 0: 1
1: 1
2: 0
3: 6
4: 141
1168217878_1168217881 6 Left 1168217878 19:54939680-54939702 CCCTTCTCCATCTGCAGCTTCAG 0: 2
1: 1
2: 3
3: 58
4: 549
Right 1168217881 19:54939709-54939731 GCACACAATCCAGCACACCGCGG 0: 1
1: 1
2: 0
3: 6
4: 115
1168217878_1168217887 23 Left 1168217878 19:54939680-54939702 CCCTTCTCCATCTGCAGCTTCAG 0: 2
1: 1
2: 3
3: 58
4: 549
Right 1168217887 19:54939726-54939748 CCGCGGGGGCCGAGCCCAGCTGG 0: 2
1: 0
2: 3
3: 20
4: 299
1168217878_1168217884 9 Left 1168217878 19:54939680-54939702 CCCTTCTCCATCTGCAGCTTCAG 0: 2
1: 1
2: 3
3: 58
4: 549
Right 1168217884 19:54939712-54939734 CACAATCCAGCACACCGCGGGGG 0: 1
1: 1
2: 0
3: 4
4: 40
1168217878_1168217888 29 Left 1168217878 19:54939680-54939702 CCCTTCTCCATCTGCAGCTTCAG 0: 2
1: 1
2: 3
3: 58
4: 549
Right 1168217888 19:54939732-54939754 GGGCCGAGCCCAGCTGGAACAGG 0: 2
1: 0
2: 0
3: 14
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168217878 Original CRISPR CTGAAGCTGCAGATGGAGAA GGG (reversed) Exonic
900000660 1:13141-13163 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900020377 1:183660-183682 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900181400 1:1312592-1312614 CTGAAGCGGGAGATGGCGCAGGG - Exonic
900857585 1:5198362-5198384 AAGATGCTGCAGGTGGAGAAGGG + Intergenic
901417424 1:9127519-9127541 CAGATGCTGCAGATGGAATAGGG - Intronic
902289551 1:15427375-15427397 CTGAGGCTGCAGACAGAGATGGG + Intronic
902654614 1:17858954-17858976 CTGAGTCTGCAGATGGAGTGAGG - Intergenic
902659785 1:17893040-17893062 CAGAGGCTGCAGAAGGGGAACGG - Intergenic
902971304 1:20053707-20053729 CTAAATCTGCAGGAGGAGAAGGG - Intronic
903126380 1:21251024-21251046 CTGAATTTGCAGATGGGGTAAGG + Intronic
903424702 1:23245156-23245178 CTGAAGCTGCAGCTGTAGCCTGG - Intergenic
904586850 1:31585452-31585474 ATGAAGGAGCTGATGGAGAATGG + Exonic
904797857 1:33070958-33070980 CAGCAGCAGCAGCTGGAGAAAGG + Intronic
905199141 1:36304756-36304778 CTGGAGCTGCTGGTGGAGAACGG - Exonic
906223776 1:44104277-44104299 CTGAAGCTGGAGACGGAGCTTGG - Intergenic
906399464 1:45494484-45494506 CAGAAGCTGGAGATGAGGAAAGG + Intronic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907654346 1:56327310-56327332 CTGAAGATGGAGATGGGGATGGG + Intergenic
908171280 1:61507288-61507310 CTGAAGCCAAAGATGCAGAATGG - Intergenic
908250634 1:62263091-62263113 GTGAAGCTGCTGCTGGAGACAGG - Exonic
908847824 1:68342882-68342904 ATGAAGGTGCAGATGGGGAGTGG + Intergenic
909053964 1:70800837-70800859 CTGAAGATTCAGAAGGAGCAGGG - Intergenic
909106351 1:71414327-71414349 CTGCAGCTGCTCATGGGGAAAGG - Intronic
909151526 1:72011920-72011942 TTGAAGGTGGAGATGGAGAGTGG + Intronic
909860873 1:80604012-80604034 CTTGAGTTGAAGATGGAGAAAGG - Intergenic
910892398 1:92030984-92031006 CTGAGGCTCCAGGTGGTGAAGGG + Intronic
911122233 1:94308321-94308343 CTGAAGCAGCGGATGGGGAAGGG - Intergenic
911948580 1:104142411-104142433 CTAAATCTGCAGGTGGAGCAGGG - Intergenic
912662821 1:111548804-111548826 GTGAAGCTTGAGTTGGAGAATGG - Intronic
912702739 1:111890253-111890275 CTGAAGATGGAGATGGTGAGAGG + Intronic
913169963 1:116222778-116222800 CTGAGGCTGCAGAAGGACACTGG + Intergenic
913387258 1:118272160-118272182 ATCTAGCTGCAGAGGGAGAAAGG + Intergenic
913686293 1:121235131-121235153 CGGGAGCTGAAGCTGGAGAATGG - Intronic
914038144 1:144022766-144022788 CGGGAGCTGAAGCTGGAGAATGG - Intergenic
914151309 1:145045176-145045198 CGGGAGCTGAAGCTGGAGAATGG + Intronic
915137266 1:153741547-153741569 CAGAATCTGGAGATAGAGAAAGG - Intronic
915430374 1:155861357-155861379 CTGGAACTGCAGTTAGAGAAAGG - Intronic
915834907 1:159169017-159169039 CTGATGCTGATGATGCAGAAAGG + Intergenic
917488862 1:175480155-175480177 CTGACTATGCAGCTGGAGAATGG - Intronic
918105167 1:181410464-181410486 CAGATGCTGGAGATGGAGAAGGG + Intergenic
918442054 1:184577292-184577314 CTGGCGTTGAAGATGGAGAAAGG + Intronic
920473615 1:206253685-206253707 CGGGAGCTGAAGCTGGAGAATGG - Intronic
920676086 1:208039706-208039728 ATCAAGCAGCAGATGGAGAAGGG - Exonic
920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG + Intergenic
922427947 1:225517301-225517323 GGGCAGCTGCAGAGGGAGAAGGG + Exonic
923112568 1:230903920-230903942 CTGAAGCTGCTGAGTGAAAAGGG + Intergenic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
924579419 1:245311061-245311083 ATGAAGCTGAAGAAGGAGAAAGG + Intronic
924813674 1:247424707-247424729 CTGAAACAGCAGATGGAGAGTGG + Exonic
1062947291 10:1471257-1471279 GTGGAGCTTCAGAAGGAGAACGG - Intronic
1063040211 10:2330028-2330050 TTGAAGGTCCAGAAGGAGAAGGG + Intergenic
1064303205 10:14141093-14141115 GAGAAGCAGGAGATGGAGAATGG + Intronic
1065454862 10:25896524-25896546 CTGAAACAGCAGATCGACAATGG - Intergenic
1065791187 10:29262424-29262446 GTGAAAAGGCAGATGGAGAAAGG - Intergenic
1066491518 10:35899328-35899350 CCGTGGCTGCAGATGGAGGATGG + Intergenic
1067709548 10:48637178-48637200 CTGAAGCTGCAGATGGAGACAGG + Intronic
1067947110 10:50696557-50696579 CTGAAGCTGCAGCTGAATGAGGG - Intergenic
1068932975 10:62610499-62610521 CAGAGGCTGCAAAGGGAGAAGGG - Intronic
1069086573 10:64146843-64146865 CTGACTTTGCAGATGGAGGAAGG + Intergenic
1070746185 10:78935481-78935503 ATGAAGCTGCAGCTGGGGGAAGG - Intergenic
1070882422 10:79861547-79861569 CTGAAGCTGCAGCTGAATGAGGG - Intergenic
1071384459 10:85105457-85105479 CTGAAGCTGAGGCAGGAGAATGG - Intergenic
1071648992 10:87377858-87377880 CTGAAGCTGCAGCTGAATGAGGG - Intergenic
1071947790 10:90667186-90667208 CTCCAGCTCCAGATGGAGAGAGG + Intergenic
1072356244 10:94614532-94614554 CTGAAGCTGGAGGTGGGGCAGGG - Intergenic
1072718678 10:97767719-97767741 CTGGTGCTGCACATGAAGAATGG - Exonic
1072720710 10:97779343-97779365 CTGAGACTGCAGAGGGAGCAGGG - Intergenic
1072985966 10:100140435-100140457 CTGAAGCTTGAGATTAAGAAGGG + Intergenic
1073676010 10:105647868-105647890 CTGAAACTGCAGAGGGCAAAAGG + Intergenic
1074772774 10:116744129-116744151 CTGTAGCTGGAGCTGGAGTAGGG - Intergenic
1076265605 10:129107624-129107646 ATGAAGATGCAGATGGGGAAGGG + Intergenic
1076413166 10:130265911-130265933 ACGAAGCTGCAGATGGAGACGGG + Intergenic
1077506631 11:2932578-2932600 CCCAAGCTGCAGATGCAGAAAGG + Intergenic
1077958104 11:7043161-7043183 CTGAAGCAGCAAATGGAGAAGGG + Exonic
1078050361 11:7960500-7960522 CTGCAGGGGCAGATGGAGAGAGG - Exonic
1078645289 11:13136418-13136440 ATGAAGCTGAAGACAGAGAAGGG - Intergenic
1078970521 11:16405442-16405464 CTGAAGCTGTATTCGGAGAAGGG - Intronic
1079222773 11:18578280-18578302 CTGGCTCTGAAGATGGAGAAAGG + Intronic
1079289051 11:19169869-19169891 CTAAATCTGCAGAGGAAGAAAGG - Intronic
1080394313 11:31875902-31875924 AGGAAGCTGCAGAAGGAGGAGGG - Intronic
1081559645 11:44201775-44201797 CTGGAGCAGTAGAAGGAGAAGGG - Intronic
1081597192 11:44467385-44467407 CTGAGGCTGCAGATGGCCAAGGG + Intergenic
1081665674 11:44915791-44915813 AGGAAGCTGAAGCTGGAGAAGGG - Intronic
1082980305 11:59114766-59114788 CTGACACTGTAGAGGGAGAAAGG + Intronic
1083022175 11:59518441-59518463 ATGATCCAGCAGATGGAGAAAGG + Intergenic
1083478782 11:62930316-62930338 TTGCAGCTGCAGCTGGAGAGAGG - Intergenic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1084566678 11:69932585-69932607 TTCCAGCTGCAGGTGGAGAATGG - Intergenic
1084800891 11:71543182-71543204 CAGCAGCTGCAGGTGGAGGAGGG + Intronic
1085024791 11:73230127-73230149 CAGAAGCTGCAGGAGGAGCAAGG - Intronic
1085253210 11:75157094-75157116 ATGAAGATGGAGATGGAGATGGG + Intronic
1086147901 11:83574160-83574182 ATGAAACTGGAGTTGGAGAAAGG + Intronic
1086918339 11:92557140-92557162 CAGAAGGTGAAGATGGAGGAGGG - Intronic
1087424517 11:97970515-97970537 CTGAAGGTGCAGTTGGAGGAAGG + Intergenic
1087757525 11:102070499-102070521 CAGGAACTCCAGATGGAGAAAGG - Intronic
1088619979 11:111671888-111671910 CTGAAGCTGGAGGTGGAGCTTGG - Intronic
1089599307 11:119603808-119603830 CTGAAGCTGGAGGTGGAGCTTGG - Intergenic
1089615949 11:119694857-119694879 CTGAAGGAGCAGCTGGAGAGAGG - Intronic
1089689389 11:120177828-120177850 CTGAAGCTGCAGAGAGACAAAGG + Intronic
1089943144 11:122440529-122440551 CAAAGGCTGCAGATGGAAAATGG + Intergenic
1089945804 11:122472009-122472031 GTGAAGATGCAGAAAGAGAAAGG - Intergenic
1090075360 11:123577344-123577366 CTGCAGCGGCAGATGGAGAGAGG - Intronic
1090723984 11:129505287-129505309 CTGAAGCTGCAAATGCAGAAAGG + Intergenic
1091703802 12:2680431-2680453 CTGGAGCTGCTGATGCAGACAGG - Intronic
1091704364 12:2683884-2683906 CTGGAGCTGCCGATGCAGACAGG + Intronic
1092104949 12:5914689-5914711 CTGAAATTGGAAATGGAGAATGG - Intronic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1092188772 12:6502087-6502109 CTGATGCTGCAGAAGGAAGAGGG + Intronic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1092519983 12:9260657-9260679 CTGAATTTGAAGATAGAGAAAGG + Intergenic
1092647819 12:10597353-10597375 CTGAAGCTGCAAATGTGGATGGG + Intergenic
1092826365 12:12403506-12403528 CTGAAGCAGGAGATGAGGAAAGG + Intronic
1093127619 12:15349419-15349441 CTCCAGCTGCAAATGGGGAATGG + Intronic
1093204548 12:16231742-16231764 CTGAGGCTGAAAATGGAAAATGG + Intronic
1093434913 12:19125801-19125823 CGGAAGCTGAAGCAGGAGAATGG - Intergenic
1093498086 12:19780058-19780080 CTGTAGCTGCAGAGGCAGAGGGG + Intergenic
1094267408 12:28574577-28574599 CTGAAGCTGGATAAGAAGAAGGG + Intronic
1095594120 12:43939579-43939601 CTGAAGTGGCAGTAGGAGAAGGG - Intronic
1095905186 12:47369942-47369964 CTGATGCTGCGGATGAAGAGTGG + Intergenic
1096394021 12:51252015-51252037 CAGAAAGTGCAGATGAAGAAAGG + Intronic
1096818495 12:54216461-54216483 CTGAAGCTGCAGCAGGAGGAAGG - Intergenic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1096977862 12:55709729-55709751 CAGAAGCTGCAGGTGCAGATAGG - Intronic
1098292392 12:68968889-68968911 CTAAAGCTCCAGATTGAGGATGG - Intronic
1100088136 12:90936611-90936633 CTGCAGCTGCTGTTGGGGAAGGG + Intronic
1100357706 12:93847130-93847152 CTGAAAGTGCAGATGTAGAATGG + Intronic
1100607279 12:96162111-96162133 CATAAGCACCAGATGGAGAAGGG - Intergenic
1101279723 12:103239873-103239895 CTGAACTTCCAGATGGAGACTGG + Intronic
1101647639 12:106645915-106645937 CCTCAGCTACAGATGGAGAAAGG + Intronic
1102471674 12:113163040-113163062 CTCAGGCTGCAGAGGGAGAGTGG + Exonic
1102655804 12:114481333-114481355 CTGGCGCTGCAGAGGGAGGAAGG + Intergenic
1102656660 12:114487690-114487712 CTGAAGAAGAAGATGTAGAATGG + Intergenic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1103015693 12:117492841-117492863 CTGACTTTGAAGATGGAGAAGGG + Intronic
1103304994 12:119956988-119957010 CTGGCTTTGCAGATGGAGAAGGG + Intergenic
1103842324 12:123875267-123875289 CTGAAGCTGCTGTTGGAAAAAGG + Exonic
1104482634 12:129121562-129121584 CTGGATTTGAAGATGGAGAATGG + Intronic
1104515760 12:129424944-129424966 CTGAGGCTGCAGGTGGGGAGCGG - Intronic
1104649823 12:130523539-130523561 CTGGAGCTCCTGATGGGGAAGGG - Intronic
1104710559 12:130982806-130982828 CTGAAGTGGAAGCTGGAGAAGGG + Intronic
1104778829 12:131406732-131406754 CTGATGCTGCAGGTGGAGACAGG - Intergenic
1105727086 13:23174239-23174261 CTCAACCTGCAGATGGGGACAGG + Intergenic
1106069364 13:26392997-26393019 GTAAAGCTGCATATGGAGCATGG - Intronic
1106123977 13:26885126-26885148 GTGAGGCTGAAGAGGGAGAATGG - Intergenic
1106360761 13:29028511-29028533 CTGAAGCAGCAGAGTGAGAAAGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107175578 13:37394862-37394884 CTGCAGCTGCAGTGGGAGAGAGG - Intergenic
1107462032 13:40613523-40613545 CTCAAACTGCAGATGGGGACCGG - Intronic
1107722839 13:43267135-43267157 CTGGAGCTGCAGCTCGAGGAAGG - Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108454372 13:50598200-50598222 CGGAAGCTGCAGGGGCAGAAGGG - Intronic
1108691137 13:52860318-52860340 CTGATGCTACAGATGCAGACGGG + Intergenic
1108870911 13:54984661-54984683 CTAAAGCATGAGATGGAGAAGGG - Intergenic
1108963633 13:56268910-56268932 CTGGCACTGAAGATGGAGAAAGG - Intergenic
1109277548 13:60319411-60319433 AGGCAGCTGCAGATAGAGAAGGG + Intergenic
1109277949 13:60322863-60322885 TTGTAGCTGCAGATGGGGACTGG + Intergenic
1109391972 13:61705505-61705527 CTGATGGTGCAGATGGAGCTGGG - Intergenic
1109643186 13:65218718-65218740 ATGAAGTTGAAGATGGACAATGG + Intergenic
1110458078 13:75712250-75712272 CTGAAGTGGCAGGTGGAGCAGGG + Intronic
1113435367 13:110287012-110287034 CTGAGGCTGAGGGTGGAGAATGG + Intronic
1113658187 13:112083476-112083498 ATGAAGCTGCTGCTGGGGAATGG - Intergenic
1114585893 14:23813352-23813374 AAGAAGCTGTATATGGAGAAAGG - Intergenic
1114588376 14:23835896-23835918 GTGAAGATTCAGCTGGAGAAAGG + Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1117049980 14:51850144-51850166 CAGAAGCTGAAGAAAGAGAAAGG - Intronic
1118285596 14:64468552-64468574 CTGAAGCTGCTGATGTGGCAAGG + Exonic
1120061496 14:79988719-79988741 CTGAGCTTGAAGATGGAGAAAGG - Intergenic
1120062384 14:79999466-79999488 CTGAGTCTTCAAATGGAGAAGGG + Intergenic
1120613087 14:86666687-86666709 CTGAAGCTGAAAATGGAGTGGGG + Intergenic
1120715880 14:87840293-87840315 CTGTAACTGCAGAGGGAGACTGG - Intronic
1121308410 14:92922005-92922027 CAGCAGCCGCAGATGGAGAGGGG + Intergenic
1121365317 14:93303787-93303809 TTGAAGCAACAGATGGAAAATGG + Intronic
1122690919 14:103531848-103531870 CTGAAGCTGGAGTGGGAGGAGGG + Intronic
1122923009 14:104887649-104887671 CTGAGGCTGCGGATGGTGAGCGG + Exonic
1123043541 14:105500243-105500265 CAGAGGCTGCAGGTGGAGGAGGG - Intergenic
1123674063 15:22690641-22690663 CTGAAGCTTCTGAAGGAGGATGG - Intergenic
1124326071 15:28763633-28763655 CTGAAGCTTCTGAAGGAGGATGG - Intergenic
1124588318 15:31031437-31031459 CTACAACTGCAAATGGAGAAAGG + Intronic
1125241218 15:37578903-37578925 CTGAGGCTGCAAATGAAGAAAGG + Intergenic
1126336101 15:47587867-47587889 CTGACAATGCAAATGGAGAAAGG - Intronic
1126625293 15:50680462-50680484 GGGAAGCTGCAGCAGGAGAATGG + Intronic
1126829192 15:52582614-52582636 GTGAACCTGCAGATGAGGAAAGG - Intronic
1127012281 15:54643678-54643700 CTGCTGCTGGGGATGGAGAAGGG - Intergenic
1127311868 15:57759535-57759557 ATGCAGCTGCAGGTGGAGAAGGG - Intronic
1127503179 15:59573603-59573625 CTGGAGATGTAGATGGAGACAGG + Intergenic
1128053858 15:64685370-64685392 CTGAGGATGCATATGGAGCAGGG - Exonic
1128246011 15:66133297-66133319 CTCAAGCTGCAGTTGGGGACTGG + Intronic
1128443200 15:67732726-67732748 CTGGAGCTCCATATGGAGCAGGG - Intronic
1128842166 15:70859187-70859209 CTGAAGCTGGAGGTGGAGCTTGG + Intronic
1129227030 15:74176045-74176067 CTGAGGCTGCAGTCGCAGAAGGG + Exonic
1129295808 15:74599457-74599479 CTGAAGGCGCAGATGGAGGGAGG + Intronic
1129687192 15:77693479-77693501 ATGAAGCTGCAGAGGGAGGCTGG + Intronic
1129707091 15:77800473-77800495 CCGAAGATGGAGATGGAGCATGG + Intronic
1129993513 15:79985039-79985061 GAGAAGCTGCTCATGGAGAATGG + Intergenic
1129993658 15:79986250-79986272 GAGAAGCTGCTCATGGAGAACGG + Intergenic
1130620849 15:85460757-85460779 CTGGCTCTGAAGATGGAGAAAGG + Intronic
1131001944 15:88946056-88946078 CTGAATCTTCAGAGGGTGAAGGG - Intergenic
1131355451 15:91742038-91742060 GTGGAGATGCAGGTGGAGAATGG + Intergenic
1131535414 15:93233109-93233131 CTGCAGCTTCAGTGGGAGAAAGG - Intergenic
1131535417 15:93233120-93233142 CTGAAGCTGCAGTTTGAGATTGG + Intergenic
1131877495 15:96825993-96826015 AGGAAGCTCTAGATGGAGAATGG - Intergenic
1131877586 15:96826935-96826957 CTGAAGCTGCCTGTGGAGAAAGG - Intergenic
1132452847 15:101977804-101977826 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1132454050 16:12822-12844 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1132979016 16:2725442-2725464 CTGGCTCTGCAGATGGAGGAAGG - Intergenic
1133378806 16:5312766-5312788 CTGATGCTGCAGATGCATGAGGG + Intergenic
1135960610 16:26991699-26991721 CTGCAACTGCCGAGGGAGAAGGG + Intergenic
1136683338 16:31980485-31980507 CTGCAGCTGCTGCTGGAGAATGG + Intergenic
1136783968 16:32924041-32924063 CTGCAGCTGCTGCTGGAGAATGG + Intergenic
1136885814 16:33929765-33929787 CTGCAGCTGCTGCTGGAGAATGG - Intergenic
1137482953 16:48867506-48867528 CTCAAGCTGCAGAGAGAGAAGGG - Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1138175355 16:54893109-54893131 CTGCTGCTGCAGCTGGAGATGGG - Intergenic
1138309351 16:56009929-56009951 CTGAAGTTGGAGCTGGAGAAGGG + Intergenic
1139296704 16:65907554-65907576 CTGACGCTGAAGATGGGGCAAGG + Intergenic
1139431099 16:66911452-66911474 CTGAAGCTGGAGAGAGAGACTGG - Intronic
1140335764 16:74103625-74103647 CTGGCTCTGAAGATGGAGAAAGG + Intergenic
1140619299 16:76708506-76708528 CTGACGTTGAAGATGGAGGAAGG + Intergenic
1140806275 16:78535179-78535201 CAGAGGCTGCAGATGGACACAGG + Intronic
1141079012 16:81034760-81034782 CTGATTCTGGAGATGGAGGAAGG + Intergenic
1142220042 16:88849813-88849835 CTGAAGCTGATGAGGAAGAAAGG + Intronic
1142339245 16:89509720-89509742 CTGAAGCTTCTGCAGGAGAAAGG - Intronic
1203086624 16_KI270728v1_random:1188043-1188065 CTGCAGCTGCTGCTGGAGAATGG + Intergenic
1142687520 17:1586213-1586235 CTGAAGTTGAGGATGGAGCACGG + Intronic
1142693937 17:1623157-1623179 GTGAAGCTGCAGATGTGGACAGG - Intronic
1143315933 17:6033480-6033502 CTGAACCTGCAGGTGGGGGATGG + Intronic
1143608710 17:8005309-8005331 CTGAAGCTTGATCTGGAGAAAGG - Intronic
1143665857 17:8359673-8359695 CTGCACCTACAGATGAAGAAGGG + Intergenic
1144503484 17:15809335-15809357 CTGAAGCTGGAGCTGCAGACTGG + Intergenic
1144574826 17:16422799-16422821 GTGAAGCTCCTGGTGGAGAATGG + Exonic
1144838459 17:18171026-18171048 CTGGAGCTGCAGATGAAGGAAGG - Intronic
1144852696 17:18251991-18252013 CTGCAGCTGCAGCTGGTGAGTGG - Exonic
1145166530 17:20617047-20617069 CTGAAGCTGGAGCTGCAGACTGG + Intergenic
1146634323 17:34492847-34492869 CTGAAGATGGGGGTGGAGAATGG + Intergenic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1147024512 17:37568602-37568624 CTGAAGTTTAAGATGGACAAAGG + Intronic
1147144250 17:38476196-38476218 CTGCAGCTGCTGCTGGAGAATGG + Intronic
1148695755 17:49556986-49557008 CTGAGGCTGCGGATGGAGTGGGG - Intergenic
1149777550 17:59370159-59370181 CTGAGGCTGAGGCTGGAGAATGG - Intronic
1150470915 17:65436920-65436942 CTGCAGCTGTAGTTGGAGAGAGG - Intergenic
1151573834 17:74941376-74941398 CAGGGGCTGGAGATGGAGAAAGG - Intronic
1151656786 17:75499865-75499887 CTGAACCTGAAGATGGAGCAGGG + Exonic
1152212654 17:79010519-79010541 CTGAAGGTGCAGATGGGCAGGGG - Intergenic
1152251609 17:79215473-79215495 CTCAAGGAACAGATGGAGAAAGG - Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152509038 17:80772608-80772630 GTGAAGCTGCCGCAGGAGAATGG - Intronic
1152851107 17:82636515-82636537 CTGCAGCTGAAGAGGGGGAAAGG + Intronic
1154329507 18:13418146-13418168 AGGAAGCTACAGAGGGAGAAAGG - Intronic
1154371090 18:13763809-13763831 CTCAAGCTGCAGGTGGTGGATGG - Exonic
1155394035 18:25367714-25367736 CTGGAACTGCAGAGTGAGAAGGG + Intergenic
1156695582 18:39762241-39762263 CTGACTTTGAAGATGGAGAAGGG - Intergenic
1156935946 18:42707224-42707246 TTGAAGGTTCAGATGAAGAAGGG + Intergenic
1157941320 18:51931900-51931922 CTGAATCTGAATATTGAGAACGG + Intergenic
1158077363 18:53546150-53546172 CTGAAGATGCAGTTGAAGACAGG + Intergenic
1158339544 18:56450535-56450557 CTAGAGCTGCAGGTGCAGAATGG - Intergenic
1158925849 18:62258857-62258879 CTGAAGCTGGAGGAAGAGAAAGG + Intronic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1159378664 18:67628445-67628467 CTGAGGCTGAAGCAGGAGAATGG - Intergenic
1159897514 18:74011436-74011458 CTGTCTCTGCTGATGGAGAATGG + Intergenic
1159914494 18:74176508-74176530 CTGAAGCTGCAGAGGCGGGAGGG - Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160580456 18:79881679-79881701 CTGAATCTGGAGATGGACTATGG - Intronic
1161138621 19:2635251-2635273 CAGAGGGTGCAGATGGAGATGGG - Intronic
1161163175 19:2771889-2771911 CGGAAGGAGCAGGTGGAGAAGGG - Intronic
1161208987 19:3056577-3056599 CTGGGGCTGCGGATGGAGACTGG + Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161921301 19:7268201-7268223 CGGCAGGTGCAGAAGGAGAAAGG + Intronic
1162387474 19:10368521-10368543 CTGAAGCTGCAGGTGGGGGAGGG - Intronic
1162461560 19:10816924-10816946 CTGGAGCAGCAGTGGGAGAAGGG + Intronic
1163133091 19:15288747-15288769 CTGCCCCTGCAGATGGAGGAGGG + Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1165740626 19:38203294-38203316 CTGCAGCTGCAGAGGGAGATGGG - Intronic
1166109745 19:40614659-40614681 CTTCAGCTGCAGAGGGGGAATGG - Intronic
1166264235 19:41667851-41667873 CTGATGCTGCTGGTGCAGAAGGG - Intronic
1166740178 19:45109850-45109872 CTGAGGCTGCAGATGCAGGTGGG - Intronic
1166864228 19:45826374-45826396 CTGAGGAGGAAGATGGAGAAGGG + Intronic
1166885965 19:45961051-45961073 GTGCAGCTGCAGAAGGAGACCGG - Exonic
1167737590 19:51305717-51305739 CAGAAGCTGCAGATGGCTATGGG - Intergenic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
1168368359 19:55809543-55809565 CTGAAGCGGCAGATGGACAAGGG - Exonic
1168373754 19:55858444-55858466 CTGAAGCAAGAGATGCAGAAAGG + Exonic
1168384940 19:55955274-55955296 CTGAAACAGCAAATGGAGAGAGG + Exonic
1168476094 19:56676406-56676428 CTGTACTTGGAGATGGAGAAAGG - Intergenic
925265084 2:2561441-2561463 CAGAAGCTGGAGAGGCAGAAAGG + Intergenic
926097746 2:10093415-10093437 CTGAGGCTGAATAGGGAGAATGG - Intergenic
927151730 2:20200142-20200164 CTGCACCTGCTGATGGAGCAGGG - Intergenic
927154223 2:20212508-20212530 CTGAGGCTGCAGATGGGGTCTGG + Intronic
927497294 2:23559496-23559518 TCGTGGCTGCAGATGGAGAAGGG + Intronic
927638457 2:24832233-24832255 CAGCAGCTGCAGCTGGAGAGTGG - Intronic
927811797 2:26184575-26184597 CTGGAGCTGCAGATGCAAGAGGG + Exonic
927932621 2:27054941-27054963 CTGAATCTGCAAGTGGAGCAGGG - Intronic
928177677 2:29046160-29046182 CTCAAGCTTCAGCTGGTGAAGGG + Intronic
929305721 2:40359092-40359114 GTGAAGCTGAAGGTGGGGAAGGG + Intronic
930259593 2:49129603-49129625 CTGGAGCTGAAGATGTAGCATGG + Intronic
930347147 2:50198061-50198083 ATAAAGATGCAGATGGATAATGG - Intronic
930513302 2:52373599-52373621 TTGAAGCTGAAGATGTAGGATGG + Intergenic
930614524 2:53579486-53579508 CTGAAGCTGGGGATGGGGTAGGG - Intronic
930754586 2:54961634-54961656 CTGAGGTAGCTGATGGAGAAAGG + Intronic
931964009 2:67513472-67513494 TTGAATCTGCAGATGCAGTACGG - Intergenic
932038751 2:68276217-68276239 CTGAAGTGGCAGAGAGAGAATGG + Intergenic
935211963 2:100946001-100946023 CTGAAGCTCCTGTTGGAGAGAGG + Intronic
936465905 2:112749982-112750004 CTGAAGCTGCACAGGGAGGTGGG - Intronic
936569060 2:113600276-113600298 CTGAGGCTGAGGAGGGAGAAGGG - Intergenic
936781836 2:116042304-116042326 CTGAAGCTGTAAATGTAAAATGG + Intergenic
937053145 2:118908496-118908518 CTGAAGATCCAGCTGGGGAAAGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938370130 2:130763438-130763460 CGGAAGCTGCATATGGACAGTGG - Exonic
939238059 2:139522950-139522972 ATGAAGCTGCAGAAGTATAAAGG - Intergenic
939334393 2:140806965-140806987 CTCAAACTGCATATGCAGAAGGG + Intronic
939535110 2:143417960-143417982 CTGCAACTGCTGATGGAGTAGGG + Intronic
939961310 2:148568445-148568467 CTGAGCCTGCAGATGGTGCAAGG + Intergenic
940597617 2:155815358-155815380 CTGAAGCTGTAGGTGGGGAGAGG - Intergenic
941200683 2:162505223-162505245 ATAAAGCTGCAGAGGGTGAAAGG + Intronic
941792233 2:169565365-169565387 CTGAGGCTGAAGCAGGAGAATGG - Intronic
941932239 2:170953736-170953758 CTGAAGAACCAGATGTAGAAAGG + Intronic
942053453 2:172162263-172162285 CTCAAGCAGAAGATGGAGACAGG - Intergenic
942155628 2:173124444-173124466 CTGCAGCTGCAAATGGATGATGG + Intronic
942372096 2:175296038-175296060 CTGAGGCTGCAGAGGGAAAGGGG - Intergenic
943298795 2:186172086-186172108 CAGAAGTTGCTAATGGAGAATGG + Intergenic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
943367785 2:186982053-186982075 CTGTGGCTGCAGCTGGAGCAAGG - Intergenic
943541343 2:189218472-189218494 CAGAGCCTGCAGATGGAGCATGG + Intergenic
944532300 2:200679567-200679589 ATAAAGCTGCAGAAGGAAAAAGG - Intergenic
945450165 2:209985088-209985110 CTGAAGCTGAAAATGAAGGAGGG - Intronic
946026389 2:216674202-216674224 CTCAAGATGCAAAGGGAGAATGG + Exonic
946365391 2:219245752-219245774 CTGAAGCTGGCGACGGAGCAGGG + Intronic
946375111 2:219303096-219303118 ATGAGGCTGGGGATGGAGAAGGG + Intronic
946409826 2:219510424-219510446 CTGAGGCTGCAGAGGGCAAAGGG - Intergenic
946416068 2:219540359-219540381 CAGAAGCAGCAGCTGGTGAATGG - Exonic
946744889 2:222835847-222835869 CTAAAGCTGCAGACAGGGAATGG - Intergenic
947233857 2:227919910-227919932 CTGTAGGTGCAGAAGCAGAAAGG - Intronic
947846690 2:233250486-233250508 CTGAGGCTGTAGATGTTGAAAGG - Intronic
948513750 2:238489951-238489973 CTGAGGCTGCAGAGGGAAATAGG - Intergenic
948785552 2:240350609-240350631 CTGACGTTGAAGATGGAGGAGGG + Intergenic
1168795823 20:609735-609757 CAGAAGGTGCAGATGGAGCGCGG + Exonic
1168887346 20:1268659-1268681 CAGAGGCTGGAGATAGAGAAAGG - Intronic
1168889623 20:1286402-1286424 CTGCAGCTGGAGAGGGAGAAGGG + Intronic
1169144541 20:3243828-3243850 GAGCAGCTGCAGCTGGAGAAGGG - Intergenic
1169338047 20:4773639-4773661 CTGATTCAGCAGATGGAGTAGGG - Intergenic
1169348578 20:4850010-4850032 ATGAAGATGCAGTAGGAGAAGGG + Intergenic
1170781050 20:19425688-19425710 GTCAAGCTACAAATGGAGAATGG - Intronic
1170852989 20:20020893-20020915 TTGAAGATGCAGATGCAGGAGGG + Intronic
1171220919 20:23397139-23397161 CTGAAGCTGCATGTGGAGCTTGG + Exonic
1171234193 20:23510933-23510955 CTAATCCTACAGATGGAGAAGGG + Intergenic
1171504519 20:25623129-25623151 TTGAAGCTGAAGGTAGAGAAAGG + Intronic
1172105936 20:32517354-32517376 CAGCAGCTGGAGAGGGAGAAGGG + Intronic
1172915833 20:38443019-38443041 CTGAAGCTGAAGAGGAGGAAGGG + Intergenic
1172998421 20:39088320-39088342 TTCCAGCTGCAGAGGGAGAAGGG - Intergenic
1173151357 20:40569069-40569091 CTGCAGATGGAGATGTAGAAAGG - Intergenic
1173368909 20:42417056-42417078 TAGAAGCTGGAGAGGGAGAAAGG + Intronic
1173850456 20:46214581-46214603 CTGAAGCTAGAGATGGAGTGGGG - Intronic
1174136358 20:48382766-48382788 CACTGGCTGCAGATGGAGAAAGG + Intergenic
1175477439 20:59286870-59286892 CTCTAGCTGCATATAGAGAATGG - Intergenic
1177682385 21:24389333-24389355 CTGAAATGGAAGATGGAGAAAGG - Intergenic
1177807703 21:25890248-25890270 CAGAAGCTGCTGATGGAAATTGG - Intronic
1178150776 21:29791119-29791141 CTGAAGCTGGATCTGGAGTATGG + Intronic
1178352225 21:31880410-31880432 CTGTGGCTGCAGAGGGAGCATGG - Intronic
1178401694 21:32291799-32291821 CTGAGGCAGCAGGTGGATAATGG + Exonic
1178661673 21:34511834-34511856 CTGCAGAAGCACATGGAGAAGGG - Intergenic
1179026601 21:37683818-37683840 GTGAAGTGGCAGAGGGAGAAAGG + Intronic
1179072885 21:38089482-38089504 TTGAAGATGAAGATGGAGGAAGG + Intronic
1179495446 21:41768597-41768619 CGGAGACTGTAGATGGAGAAAGG - Intergenic
1179591871 21:42414442-42414464 CTGAGGCTGCAAAGGGTGAAGGG + Intronic
1180032836 21:45224030-45224052 CTGCACCTGCAGAAGGAGAGGGG + Exonic
1180661703 22:17473161-17473183 CTGAAGCTGCAGAGGGGCAGTGG + Intronic
1180719023 22:17893171-17893193 CTGATGCTGGGGATGAAGAAGGG - Intronic
1181864741 22:25846269-25846291 ATCAAGCTGCAGATGGTGAGTGG + Exonic
1181894029 22:26090954-26090976 CTGAAGCAGCAGACCCAGAAGGG - Intergenic
1182010230 22:26994670-26994692 TTGATGCTGGAGATGGGGAAGGG + Intergenic
1182294426 22:29304844-29304866 CTGAGGCAGGAGAAGGAGAATGG - Intergenic
1182630930 22:31684627-31684649 TAGAAGCTGGAGATGGGGAAGGG + Exonic
1183098189 22:35567129-35567151 CTGAGGCTTCAGGAGGAGAAGGG - Intergenic
1183523602 22:38310732-38310754 CTTATGATGCAGAGGGAGAAGGG + Intronic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1183988869 22:41584753-41584775 ACCAAGCTGCAGAGGGAGAAAGG - Intronic
1184249409 22:43251593-43251615 CTGGCTCTGCAGGTGGAGAAGGG + Intronic
1184457324 22:44618569-44618591 CTCCAGGTGCAGAGGGAGAAGGG + Intergenic
1184999837 22:48238617-48238639 CTGAAGCCTGAGAGGGAGAATGG + Intergenic
1185267568 22:49912281-49912303 CTGCAGCTTCAGCTGGTGAACGG - Intronic
949510210 3:4760731-4760753 CTAAACCTGAAGATGGAGGAAGG - Intronic
950662551 3:14475574-14475596 CTGAAGAGGCTGGTGGAGAAGGG + Intronic
951168538 3:19510959-19510981 CTGAAGATGATGGTGGAGAAGGG + Intronic
952233652 3:31456629-31456651 CCGAAGCTGCTGGTGGAGAATGG - Intergenic
952899559 3:38100394-38100416 CTGGAGCTGGAGGTGGAAAATGG + Exonic
953210152 3:40868471-40868493 GGGTAGCTGCAGAGGGAGAATGG - Intergenic
953759375 3:45674661-45674683 CTGAAGCTGCAGAGCTAGGAGGG + Intronic
953819878 3:46198286-46198308 CTGATACTGGAGAAGGAGAATGG + Intronic
954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG + Exonic
954211491 3:49100024-49100046 ATGAAGCTGGTGATGGAGGATGG - Exonic
955281882 3:57601555-57601577 TGGAACCTGCAGATGCAGAATGG + Intergenic
956345493 3:68273317-68273339 TAGAAGTTGCAGTTGGAGAAAGG + Intronic
956930421 3:74037148-74037170 GTGAACCTGCAGATGGCGAAGGG - Intergenic
957684696 3:83486643-83486665 CTGAATCTGGAGGTGGACAAGGG + Intergenic
958619881 3:96544407-96544429 CTGAAGTGGCAGATGAATAAAGG + Intergenic
959255612 3:104008349-104008371 GTGAAGATGCAGATGTTGAAAGG - Intergenic
960039202 3:113132590-113132612 CTAATGCTGTAGATGGAAAAGGG - Intergenic
960202239 3:114850805-114850827 CTAAAGCTCCAGGTGGAGAGAGG + Intronic
960506975 3:118505603-118505625 CAGAAGGTGCAGGTGGGGAATGG - Intergenic
960717651 3:120593592-120593614 TTGAATCTCCAGGTGGAGAACGG + Intergenic
961456669 3:127027979-127028001 ATCAAGCAGCAGATGGAGAAGGG + Exonic
961485316 3:127211825-127211847 CTGAGGCTTCAGTTGGAGGAGGG + Intergenic
961957677 3:130821005-130821027 CAAAAGGGGCAGATGGAGAAAGG + Intergenic
962391929 3:134979428-134979450 CTGAAGCTATTTATGGAGAATGG - Intronic
963220649 3:142807944-142807966 GTGAAACTGCAGATAGATAAAGG - Intergenic
963249760 3:143092276-143092298 TGGCAGCTGCAGAGGGAGAAAGG + Intergenic
963803665 3:149701448-149701470 CTGGAGCTGCCGGTGGAGAATGG - Intronic
964283511 3:155092834-155092856 CTGAGGCTGGAGATGAAGCAGGG + Intronic
964298935 3:155266193-155266215 GTGAAGGTGCAGAGGGAAAAAGG + Intergenic
965621344 3:170644950-170644972 GTGAAGCTGTAGAGGGAGGAGGG - Intronic
965742701 3:171892595-171892617 CTGAATTTCCAGATGGAGAAAGG - Intronic
965838414 3:172876755-172876777 CTCAGGCTGCAGATGGACAGAGG - Intergenic
966126623 3:176584784-176584806 CTGAAGCAACAGAGGAAGAATGG + Intergenic
966551855 3:181214184-181214206 CTGAAGCTGAGGATGATGAAAGG - Intergenic
967108017 3:186269518-186269540 CTAAAGCTGAGGAAGGAGAAGGG - Intronic
968292052 3:197546639-197546661 GTGAAGCTGCAGCTTGAGAGAGG - Intronic
968598870 4:1499747-1499769 CTGAGTCTGCAGATGGGGACAGG - Intergenic
968660048 4:1795076-1795098 CTGCAGCCGCCGACGGAGAAAGG - Intronic
968872917 4:3250607-3250629 TGGAAGCTGCAGGGGGAGAATGG + Intronic
969964843 4:10983505-10983527 CTGACGCTGCAGGATGAGAAAGG + Intergenic
970866057 4:20760028-20760050 CTGAAGCTGCAAATTCAGAGGGG + Intronic
971118198 4:23673055-23673077 CTGATGTTGAAGATGGAGGAAGG + Intergenic
971215333 4:24657304-24657326 CGTAAGCTGCAGCAGGAGAAGGG - Intergenic
971234970 4:24832971-24832993 CAGAAGTTGCAGATGTAGAATGG - Intronic
974002329 4:56524243-56524265 CTCAAGCTCCTGATGGAAAATGG - Exonic
974439590 4:61899088-61899110 ATGGAGCTGCAGAGGTAGAAAGG - Intronic
974671058 4:65030842-65030864 TGGAAGCTGCAGAGGGGGAAAGG - Intergenic
975033974 4:69658517-69658539 CTGCAGCTGCTGTTGGAGATGGG - Intergenic
975363899 4:73505449-73505471 CTGAAGGTGCAGAGTGAGAAAGG + Intergenic
976867185 4:89743498-89743520 CAGATGCTGAAGATGAAGAAAGG + Intronic
976945047 4:90754931-90754953 CAGAAGCTGGAGATGAGGAAAGG - Intronic
977444333 4:97110176-97110198 CAGAAGCTGGAGAATGAGAAAGG - Intergenic
978270332 4:106881816-106881838 CTGAAACTTCAGATGGGAAATGG - Intergenic
978936334 4:114381516-114381538 CTGAAGCTGCATGTTGAAAAAGG + Intergenic
979149373 4:117290066-117290088 TTGAAGCTGCAGAAAGTGAAAGG - Intergenic
979980431 4:127248037-127248059 CTAAAGCTGCAGAGGTAGGATGG - Intergenic
980314864 4:131185669-131185691 TTGGTGCTGTAGATGGAGAAAGG + Intergenic
981101638 4:140835374-140835396 CTAAAGCTGCCGGAGGAGAAAGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982553337 4:156830448-156830470 CTGTAGGTCCACATGGAGAATGG - Intronic
983620660 4:169757874-169757896 CTGGCGCTGCAGCTGCAGAATGG - Exonic
984029123 4:174581523-174581545 CTGAAGCTTGAGAAGGAGAGAGG - Intergenic
984121118 4:175745807-175745829 CTGAGGCTGGAGAAGGAGATGGG + Intronic
985229333 4:187798522-187798544 CTGCAGCTGCTGCTGGAGGATGG - Intergenic
985393713 4:189518372-189518394 CTGATGCAGCAGATGTAGCATGG + Intergenic
985665874 5:1181289-1181311 CAGAAGCCTCAGAAGGAGAAGGG - Intergenic
985741713 5:1621217-1621239 CTGCAGCTGGAGATGCAGACAGG - Intergenic
986131686 5:4937873-4937895 CTGAAGGAGCAGGTGGAGCATGG - Intergenic
986624892 5:9714711-9714733 CTGAAGCTTTAAATTGAGAATGG + Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
987007597 5:13726089-13726111 CTGATGCTGCCTATGGGGAATGG + Intronic
987856092 5:23422731-23422753 TTGCAGCTGCTGATGGAGAGAGG - Intergenic
988738346 5:34044943-34044965 CTGGAGCTGGAGCTGGGGAAAGG + Intronic
988882534 5:35518802-35518824 CTGAAGTTCCAGATGGAGGGAGG - Intergenic
988925842 5:35990660-35990682 GTGAAGCTGCATATGGAGCCAGG - Intronic
989461271 5:41701416-41701438 CTGAATGTGAAGCTGGAGAAAGG - Intergenic
989602199 5:43210705-43210727 GTGAACCTGCAGAGGGTGAAGGG - Intronic
989986567 5:50705895-50705917 CTGACCCTCCATATGGAGAATGG - Intronic
991247598 5:64524771-64524793 CTGAAGCAGGAGAGGGAGAGAGG - Intronic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992206055 5:74431191-74431213 CAGATGCTGCAGAGGGGGAAAGG - Intergenic
992508387 5:77409868-77409890 CTCAAGTTCCAGGTGGAGAATGG - Intronic
992831678 5:80599292-80599314 CTAAAGCTGGAGATGCAGGAGGG + Intergenic
994156383 5:96508202-96508224 ATGATGCTGCAAAAGGAGAACGG + Intergenic
994780866 5:104088417-104088439 TTGAATCTGCAGATGAAGAATGG - Intergenic
995554921 5:113317780-113317802 ATGAAGATGCAAATGGAAAAAGG + Intronic
995989608 5:118221438-118221460 CAGAAGCTGCAGAAGAAAAATGG - Intergenic
996542663 5:124646802-124646824 CTGAAGCTGCTGCTGGTGATTGG + Exonic
997370624 5:133357376-133357398 CTGAAGATGCAGCTAGAGAGAGG - Intronic
998560785 5:143169724-143169746 CGGACTCTGCGGATGGAGAAGGG + Intronic
998989085 5:147795252-147795274 CTGAAGGTGTGGATGGAGGAGGG - Intergenic
999192267 5:149757170-149757192 CTGAAGCTGGAGAATCAGAAAGG + Intronic
999446686 5:151646022-151646044 CTGAAGCAGCAGAGGATGAATGG + Intergenic
999587553 5:153107893-153107915 ATAAAACTGGAGATGGAGAAAGG - Intergenic
999694065 5:154172876-154172898 CTGAGGCTGAAGATGGGGCAAGG - Intronic
999951306 5:156654040-156654062 GTGAATCTGCAGATAGTGAAAGG - Intronic
1000118883 5:158178188-158178210 CTGTAACTGCAGAGAGAGAAGGG - Intergenic
1000972876 5:167734145-167734167 ATGAAAATGCAGATGGAGCAAGG + Intronic
1002556870 5:180048746-180048768 CTGAAGCTACAGATGGCAAAGGG - Intronic
1003015237 6:2462676-2462698 TGGAAGAGGCAGATGGAGAAGGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1004969449 6:20892645-20892667 ATGATTCTGTAGATGGAGAAAGG - Intronic
1006285836 6:33093142-33093164 ATGAAGGAGAAGATGGAGAATGG + Intergenic
1006376904 6:33676751-33676773 CTGAACCTGAAGGTGGAGGATGG - Exonic
1007067081 6:39001653-39001675 CAGAAGCTGGAGATAGAAAAAGG + Intronic
1008340787 6:50361595-50361617 CTGGGGCTGCAGATGGAAAGAGG + Intergenic
1009042478 6:58195873-58195895 CTGAGGCTGCAGAAAGAAAATGG - Intergenic
1009218318 6:60950095-60950117 CTGAGGCTGCAGAAAGAAAATGG - Intergenic
1009395299 6:63193147-63193169 CTGAAGCTGGAGGTGGAGCTTGG - Intergenic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1009702796 6:67204304-67204326 CTGAAGCTGAGGGAGGAGAATGG + Intergenic
1010178400 6:73055951-73055973 TTGCAGCTGCAGATGGGGACCGG + Intronic
1010572697 6:77496914-77496936 CTGTCTCTGAAGATGGAGAAAGG - Intergenic
1011893580 6:92196734-92196756 CTGAAAGTGCAGATTGAAAAGGG + Intergenic
1012123819 6:95400869-95400891 CAACAGCAGCAGATGGAGAAGGG - Intergenic
1013086207 6:106859872-106859894 CTGCAGCTGGAGCTGGGGAAAGG + Intergenic
1013192251 6:107813502-107813524 TTGAAGCTGGAGGTGGGGAATGG + Intronic
1014806681 6:125838054-125838076 GTGAAGCTTCAGAGGGTGAAGGG - Intronic
1015022177 6:128489859-128489881 CTGAAAATGCAGATGCAGAATGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017561823 6:155636400-155636422 CTCAACCTGCAGAAGGATAAGGG + Intergenic
1017822272 6:158057897-158057919 CTGGAGCTGCACGTGGAGACGGG + Intronic
1018060938 6:160089174-160089196 CAGGAGGTGCAGATGGTGAATGG + Exonic
1018278994 6:162164305-162164327 CTGAGGCAGGAGATGGAGATGGG - Intronic
1018393780 6:163361355-163361377 GGGAAGTTGCAGATGCAGAAGGG - Intergenic
1019161282 6:170068355-170068377 CTGAGGCTCCAGGTGGAGCAGGG - Intergenic
1019701364 7:2476337-2476359 CTGGACCTGGAGAAGGAGAACGG - Intronic
1020201526 7:6083808-6083830 CTGAATATGCAGATTGAGTAAGG - Intergenic
1020588967 7:10109799-10109821 CTGTAGCATCATATGGAGAAAGG - Intergenic
1020885896 7:13819065-13819087 AAGAAGCAGCAGATGGATAAGGG + Intergenic
1021769275 7:23982685-23982707 CTGAATCTAAAGATTGAGAAAGG + Intergenic
1022857750 7:34332227-34332249 CTGAAGTTGCAGGTGCAGGAAGG - Intergenic
1023624649 7:42103798-42103820 CTCAAGCTTCAGATGTAGATTGG + Intronic
1023902560 7:44494184-44494206 CAGACGCTGCATCTGGAGAAGGG + Intergenic
1024264874 7:47598796-47598818 CTGAAGCTGTAGAAGGAGGCAGG - Intergenic
1024361564 7:48474127-48474149 GTGAAGCTTCAGAGGGTGAAAGG - Intronic
1026666528 7:72345276-72345298 TTGAAACTGCACATGGTGAATGG + Intronic
1027557713 7:79686875-79686897 CTGGCTCTGAAGATGGAGAAAGG - Intergenic
1027724053 7:81780867-81780889 CTGATTTTGAAGATGGAGAAAGG + Intergenic
1029540124 7:101177926-101177948 CTGGAGCTGCAGATGGAGTCAGG - Intronic
1030426956 7:109390182-109390204 CAGAAGCTTCAAATTGAGAATGG + Intergenic
1031900111 7:127399568-127399590 CTGATGGTGCATATGGAGAGAGG - Intronic
1031905627 7:127457422-127457444 CTGCAGCTTGAGGTGGAGAAGGG - Intergenic
1032468921 7:132164227-132164249 ATCAAGCAGCAGATGGAGAAGGG - Exonic
1032488453 7:132305975-132305997 CTGGAACTGTAGATGGAGAGGGG + Intronic
1032506212 7:132436486-132436508 GTGAAGGTGCAGGTGGAGGAAGG - Intronic
1034548769 7:151807062-151807084 CTGAAGGTGGAGGTGGGGAAGGG + Intronic
1035070166 7:156138615-156138637 CTGAATGTGCTGATGGAGGAGGG + Intergenic
1035148514 7:156844824-156844846 CTGATGCTGCTGATCAAGAATGG + Intronic
1035451345 7:158979129-158979151 CTACAGCTGCAGATGGAGCTGGG + Intergenic
1035819049 8:2571928-2571950 CTGAGTCCGCAGATGCAGAAGGG - Intergenic
1036777196 8:11621560-11621582 CTGCAGCTGGAGATGGAAGATGG - Intergenic
1037072946 8:14675041-14675063 CTGAGGCTGAAGCAGGAGAATGG - Intronic
1037514135 8:19612661-19612683 CGGAAGCTACACAAGGAGAATGG - Intronic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040740045 8:50562422-50562444 CTGGCTCTGAAGATGGAGAAGGG + Intronic
1041644068 8:60233618-60233640 CTGTTGTTGCAGCTGGAGAAGGG - Intronic
1041957362 8:63570745-63570767 CTGACTTTGAAGATGGAGAAGGG + Intergenic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1042708713 8:71691050-71691072 CTGACTTTGAAGATGGAGAAAGG - Intergenic
1043331721 8:79124711-79124733 GTGAAGGTGGAGATGGAGAAAGG + Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045064930 8:98436291-98436313 TTGAGGCTGCAGTTGGATAAAGG - Intronic
1046138683 8:110062382-110062404 CTGAAGCTGGATAGGGAGATGGG - Intergenic
1046480994 8:114818317-114818339 CTGCAGCTGAAGCAGGAGAATGG + Intergenic
1047035706 8:120936622-120936644 CTGAAGCTGGAGATGGGTAATGG + Intergenic
1047487646 8:125346331-125346353 CTCAAGATAAAGATGGAGAATGG + Intronic
1047915754 8:129582252-129582274 CTCAAGGTGCAGAGGGAGATTGG + Intergenic
1049883470 9:13254-13276 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1050670825 9:7995562-7995584 CTGAGGCAGGAGATGGAGATGGG - Intergenic
1051235357 9:14993328-14993350 CTGGCGCTGCAGCTGCAGAATGG + Intergenic
1051505131 9:17818605-17818627 CAGAAGGTGAACATGGAGAAAGG - Intergenic
1051848619 9:21481437-21481459 CTGAAGCATCTCATGGAGAATGG + Exonic
1051975080 9:22939308-22939330 CTGACTCTGAAGATGGAGAAAGG + Intergenic
1052069682 9:24067082-24067104 CTGGAACTGGAGAGGGAGAAAGG + Intergenic
1052389559 9:27863203-27863225 CTTAAGCAGTAGATGGAGTAAGG - Intergenic
1055164842 9:73178627-73178649 CTGAAGCTGAAAATGGAGGATGG + Intergenic
1057113126 9:92493061-92493083 ATGTAGCTGGAGCTGGAGAAAGG + Intronic
1057313841 9:93956920-93956942 CAGCAGCTGGAGCTGGAGAAAGG - Intergenic
1057776127 9:98011337-98011359 ATGAAGATGAAGATGTAGAAGGG + Exonic
1058536951 9:105971273-105971295 CTGATGATGAAGATAGAGAAGGG + Intergenic
1058690768 9:107518719-107518741 GTGAAGCTCCAGCTGGAAAAGGG - Intergenic
1059316252 9:113428185-113428207 CAGCAGCAGCAGATGGAAAAAGG + Exonic
1059358520 9:113720072-113720094 CTCCAGCTGCAGATGGAGGCGGG - Intergenic
1059405643 9:114097202-114097224 CTGAAGCTGCAGCTGCAGTCTGG + Intronic
1059476503 9:114551849-114551871 TTGTAGGTGAAGATGGAGAATGG - Intergenic
1060432481 9:123562135-123562157 CTGAAGGTGATGATGGTGAAGGG - Intronic
1060860309 9:126948631-126948653 CTGAAGCTGAGGAGGCAGAAGGG - Intronic
1061113569 9:128593093-128593115 GAGAAGCGGCAGAGGGAGAATGG - Intronic
1061510281 9:131056912-131056934 CTGGACCTGCAGAGCGAGAAGGG - Exonic
1062357989 9:136174049-136174071 CTGAGGCTGCAGACTCAGAAAGG + Intergenic
1062554378 9:137107358-137107380 ATGAACCGGCAGATGGAGACGGG + Exonic
1185815350 X:3150037-3150059 GTGAAGATGGAGATGGAGATTGG - Intergenic
1185839661 X:3376826-3376848 CTGGCTTTGCAGATGGAGAAAGG - Intergenic
1186880152 X:13857008-13857030 CTGACTTTGAAGATGGAGAAAGG - Intronic
1187485757 X:19701576-19701598 CTGAAGATGCAGATGGTGAGTGG - Intronic
1187975677 X:24702443-24702465 CTGCAGCTGCCCATGGGGAAAGG - Intronic
1188562944 X:31490449-31490471 CTGAGGCAGGAGAAGGAGAATGG + Intronic
1188964167 X:36530276-36530298 CTAAAGGTGGAGATGGATAAAGG + Intergenic
1189910974 X:45810289-45810311 TTGAAGCTGCAAAGAGAGAAGGG + Intergenic
1189917275 X:45868261-45868283 CTGACTGTGAAGATGGAGAAAGG + Intergenic
1190256276 X:48765102-48765124 CTGAAGCTGCAGAATGGGAAAGG + Intronic
1190715924 X:53103532-53103554 CTGAAGTGGCAGAGGGCGAAGGG - Intergenic
1190900967 X:54672739-54672761 CTGAAGTTGTAGATGCAGATGGG + Intergenic
1191842830 X:65525153-65525175 CTGAAGCAGCATAGGGAGGAGGG + Intronic
1192046881 X:67685055-67685077 CAGAAGCTGAAGCTGGAGCACGG + Intronic
1192173692 X:68873046-68873068 CTGAGGCCCCAGAGGGAGAAAGG - Intergenic
1192546670 X:72019961-72019983 CAGAGGAAGCAGATGGAGAAGGG - Intergenic
1192860873 X:75069137-75069159 CTGAAATTGGAGATGAAGAAAGG + Intronic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1193996875 X:88375814-88375836 TTGAAGCTGGAGCTGGATAATGG - Intergenic
1194076399 X:89399967-89399989 CTCAAGCTGCAGTAGCAGAAGGG + Intergenic
1194960878 X:100234286-100234308 CTGACTTTGAAGATGGAGAAAGG + Intergenic
1196395733 X:115260152-115260174 CTGAGGCTGAGGCTGGAGAATGG - Intergenic
1196631634 X:117947437-117947459 ATGAAACTGCAGATGTAAAAGGG + Intronic
1196794419 X:119490768-119490790 CTGCACCTGCAGAGGGAGATTGG - Intergenic
1197094325 X:122575008-122575030 CTGAAGCTGCACAGGGAAAACGG + Intergenic
1198025375 X:132700715-132700737 TTCAATCTTCAGATGGAGAATGG + Intronic
1198547341 X:137706587-137706609 CTGCAGCTGGGGATAGAGAAGGG - Intergenic
1199007100 X:142713263-142713285 CTGAAGCTGCTGAAGCACAAAGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199539342 X:148941672-148941694 CTGAAGCTGAAGAAGGAGTTGGG + Intronic
1199839840 X:151633609-151633631 ATGTAGCTGAAGATGGAGTATGG - Intronic
1199927185 X:152480048-152480070 CTGAAGCTGGAGACGGAGCTTGG + Intergenic
1199995340 X:153021171-153021193 CTGAATCTGGAAATCGAGAAGGG + Intergenic
1200236185 X:154468862-154468884 ATCAAGCAGCAGATGGAGAAGGG + Exonic
1200402346 X:156026895-156026917 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1201236155 Y:11914039-11914061 CTGGCTTTGCAGATGGAGAAAGG + Intergenic
1201265948 Y:12206689-12206711 GTGAAGATGGAGATGGAGATCGG + Intergenic
1201900535 Y:19043183-19043205 CTGTAGCTGCAAAAGGACAAGGG - Intergenic
1201906782 Y:19093557-19093579 CAGGAGCTGGAGATGGAGGAGGG - Intergenic