ID: 1168224820

View in Genome Browser
Species Human (GRCh38)
Location 19:54987137-54987159
Sequence CCCCCACCCCACCCCGCCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 836
Summary {0: 1, 1: 0, 2: 15, 3: 118, 4: 702}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168224812_1168224820 -1 Left 1168224812 19:54987115-54987137 CCTCAGGTGATCTACCCCCCCAC 0: 1
1: 7
2: 76
3: 530
4: 5356
Right 1168224820 19:54987137-54987159 CCCCCACCCCACCCCGCCGTCGG 0: 1
1: 0
2: 15
3: 118
4: 702
1168224810_1168224820 22 Left 1168224810 19:54987092-54987114 CCAGGCTGGTCTCGAACTCATGA 0: 363
1: 55464
2: 164447
3: 229766
4: 180229
Right 1168224820 19:54987137-54987159 CCCCCACCCCACCCCGCCGTCGG 0: 1
1: 0
2: 15
3: 118
4: 702

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168224820 Original CRISPR CCCCCACCCCACCCCGCCGT CGG Intronic
900135577 1:1115736-1115758 CCCCCTCCCCACCCCTCCCCGGG + Intronic
900284009 1:1890723-1890745 CCCCCACCCCACCCGCCGGTCGG - Intronic
900373739 1:2343984-2344006 CCCCCACCCCACCCTGCCCCTGG - Intronic
900412795 1:2520511-2520533 CCCCCACCCCAACCGCCAGTGGG + Intronic
900462192 1:2807033-2807055 CCCCACCCCCACCCCGCAGGAGG - Intergenic
900486676 1:2925987-2926009 CCACCACCCTGCCCTGCCGTGGG + Intergenic
900509737 1:3052887-3052909 CCCCCACCCCACCTCGAGGGAGG + Intergenic
900577988 1:3393851-3393873 CCCCCGCCCCGCCCCGCCTCGGG + Intronic
900698930 1:4032004-4032026 CCCCCCCCCCACCCCACCCAAGG - Intergenic
901158764 1:7158954-7158976 CCCCCACCTCACCCCAACTTAGG - Intronic
901401917 1:9020553-9020575 CCCCCCCACCCCCCCGCCTTTGG + Intronic
901441383 1:9280434-9280456 CCCACTCCCCGCCCCGCCGCTGG + Intergenic
901513796 1:9731691-9731713 CCCTGCCCCCACCCCACCGTGGG - Intronic
901607624 1:10471946-10471968 ACCCCTCCCCACACCGCCGTGGG + Intronic
901608264 1:10475762-10475784 ACCCCACCCTACCCCACCTTTGG - Intronic
901672257 1:10862809-10862831 CCCCCTCCCCAGCCCCCAGTGGG + Intergenic
901917509 1:12511284-12511306 CTCCCACCCAGCCCCGCCCTAGG - Exonic
902367896 1:15989416-15989438 CCCCTACCCCACCCTGGCGCAGG - Intergenic
902741190 1:18439500-18439522 CCCCCACCCCACCCTGAGGAGGG - Intergenic
902903538 1:19537224-19537246 GCCCCTCCCCACCCCGGCCTTGG + Intergenic
902916672 1:19644068-19644090 CGGCCGCCCCACCACGCCGTCGG + Intronic
902920763 1:19665064-19665086 CCCCCTCCCCACCCGGCAGCAGG - Intergenic
903184722 1:21622563-21622585 CCCCCTCCGGGCCCCGCCGTGGG - Intronic
903380994 1:22896746-22896768 CCCCGACCCCACCCCATCCTGGG + Intronic
903407936 1:23114403-23114425 TCCCCACCCCATCCTGCCATCGG - Intronic
903609467 1:24599821-24599843 CCCCCCCCCCCCCCCCCCCTTGG + Intronic
903643490 1:24876324-24876346 ACCCCACCCCACCCCACCCAGGG - Intergenic
903893044 1:26582939-26582961 CCACCACCCCCGCCCGCTGTGGG + Intergenic
903907361 1:26696330-26696352 CCCCCCTCCCACCCCGCCCCGGG - Exonic
904017719 1:27435622-27435644 ACCCCACCCCACCCCACCCCAGG - Intronic
904274368 1:29370675-29370697 CCCCAACCCCAGCTCACCGTGGG - Intergenic
904663050 1:32099313-32099335 CCCCCACCCCACCCCACCACAGG - Intronic
904918151 1:33985240-33985262 CATCCACCCCACCCCTCCCTGGG + Intronic
905153102 1:35948463-35948485 CCCCGCCCCCACCCCACCGCCGG + Intronic
906199026 1:43947485-43947507 CCCTCACCCCACCACTCCCTGGG + Exonic
907011473 1:50968098-50968120 ACCCCTGCCCACCGCGCCGTCGG + Exonic
907038371 1:51236459-51236481 TCCCCACCCCGCCCCCCCGCGGG - Exonic
907051062 1:51330293-51330315 CCCCCACCCCGCCCGGCCCCTGG - Intronic
907430239 1:54406952-54406974 CCCCCAGCCCGCCCCGCCCCCGG + Intronic
907509177 1:54945723-54945745 GCCCCACCCCACCCCTCTGTGGG - Intergenic
907922633 1:58927960-58927982 CCTCCACCCCACCCCACCCCAGG + Intergenic
907998336 1:59655425-59655447 CCTCCACCCCACCCCACCACAGG + Intronic
908823858 1:68115098-68115120 CCCCCACCACACCCGGTCATGGG + Intronic
909395550 1:75167564-75167586 CCCACACCCCACCCCAATGTGGG + Intergenic
909632268 1:77779745-77779767 TCTCCACCCCACCCCGCCCCTGG - Intronic
910622630 1:89273452-89273474 TCCCCACCTCACCCCGCCATGGG - Intergenic
910771513 1:90836225-90836247 CGTCCACCCCGCCCCGCCGGGGG - Intergenic
912232848 1:107815870-107815892 CCCCCTCCACACCCCGCCACGGG - Intronic
912372571 1:109185267-109185289 CCCCCACCCCACCTAGCCCTAGG - Intronic
912513381 1:110203039-110203061 CCCCCACCCCACCCAGCTCCAGG + Intergenic
912568625 1:110606465-110606487 CCCAGACCCCTCCCCGCCCTGGG - Intronic
913120804 1:115738885-115738907 CCCCCACCCCATCCTGCTTTTGG + Intronic
914718048 1:150267789-150267811 CCCCTACCCCACCCCACCCCAGG - Exonic
914756048 1:150562130-150562152 CCTCCACCCCACCCCTCCCTGGG - Intergenic
915444637 1:155967701-155967723 CCTCCACCCCACCTTGCCATGGG + Intronic
915549861 1:156625548-156625570 CCGCCTCCCCTCCCCGCCGCCGG - Exonic
916459685 1:165010611-165010633 CCCCCGCCCCACCCCGATGCTGG + Intergenic
916518703 1:165544209-165544231 CCCCCGCCCCACCCCCCCACCGG + Exonic
916666332 1:166971094-166971116 CCCCCAACCCAGCCTGCAGTGGG - Intronic
918076220 1:181173426-181173448 CCCCCACCCCACCCCACACATGG - Intergenic
919630974 1:199959892-199959914 GCCTCCCCCCACCCCGCCATGGG + Intergenic
919972395 1:202589737-202589759 CCCTCACCCTACCCAGCCTTAGG + Exonic
920284585 1:204870537-204870559 TCCCCACCCCACCCCCGCCTTGG + Intronic
920357593 1:205386171-205386193 TCCCCACCCCACCCTGCGCTGGG - Intronic
921382265 1:214536154-214536176 CCCCCACCCCACCCCGGCCTTGG - Intronic
922234540 1:223712941-223712963 CCCCCGCCCCAGCGCGCCGCGGG - Intronic
922501027 1:226096986-226097008 CCCCCACCCCACACAGAGGTAGG - Intergenic
923146766 1:231203786-231203808 CCCCCACCCCACCCCATCCCAGG - Intronic
923274053 1:232381356-232381378 ACCCCACCCCACCCACCCTTCGG + Intergenic
923614345 1:235524465-235524487 CCTCCACCCCACCCCACTGCAGG - Intergenic
924414853 1:243849427-243849449 CCCCCACCCTTCCCCGCCACTGG - Intronic
1062923980 10:1300402-1300424 CCCCCACACCACCTCTCCTTGGG + Intronic
1063403767 10:5773155-5773177 CCCCCACCCCACCACCCAGGAGG + Intronic
1063972485 10:11390883-11390905 CCCCCACCCTTCCCAGCCTTTGG - Intergenic
1065071465 10:22028870-22028892 CCCCCATCCCACCCAGCCCATGG - Intergenic
1065230142 10:23589926-23589948 CCCCCACCCCACCCCACAACAGG + Intergenic
1065342723 10:24722818-24722840 TCCCCACCCAGCCCCGCCGCGGG - Intronic
1065476108 10:26139656-26139678 CCCCCACCGCACCCCAACCTTGG - Intronic
1065636905 10:27743175-27743197 CCCCCACCCCTCCGGGCCGCAGG + Intronic
1067010976 10:42713456-42713478 CCCCCACCCCACCCCACGACAGG - Intergenic
1068548941 10:58385130-58385152 GCCTCACCCCAACCCGGCGTTGG - Exonic
1068706451 10:60081327-60081349 CCCCCACCCCATCCCCGCCTCGG + Intronic
1069939985 10:71948733-71948755 ACCCCACCCCACCCTACCGGTGG - Intergenic
1070102605 10:73402312-73402334 CCCCCTCCCCACCCCGTAGCTGG + Intronic
1071601555 10:86961030-86961052 CCCCCGCCCCACCCCCAGGTAGG - Intronic
1072424540 10:95318805-95318827 CCCCCACCCCACCCCATCTGTGG - Intronic
1072741309 10:97911581-97911603 GCCCCACCTCAGCCCCCCGTTGG - Intronic
1073136950 10:101225483-101225505 CCCCCGCCCCAGCCGGCCTTGGG + Intergenic
1074311680 10:112327937-112327959 CCCCCACCCCATTCCTCCCTGGG - Intergenic
1074444296 10:113506133-113506155 CCCACACCCAACCCAGCCCTTGG + Intergenic
1074560926 10:114534491-114534513 CCCCACCCCCACCCCGCCTCAGG - Intronic
1075074744 10:119343198-119343220 CCCCTTCCCCACCCCGCCCTTGG - Intronic
1076777871 10:132708079-132708101 CCCCCACCCCACCCCAGGCTGGG + Intronic
1076900784 10:133336427-133336449 CGCCCTCCCCACCCCGCCTCCGG + Intronic
1077043735 11:535455-535477 CCCCCGCCCCGCCCCGGCCTCGG - Exonic
1077107057 11:846726-846748 CCCCTACCCCACCCTGCCTTGGG - Intronic
1077225099 11:1436163-1436185 TCCCCGCCCCACCCCACCGCCGG - Intronic
1077333602 11:1993963-1993985 CCCCCTCCCCATCCAGCTGTGGG - Intergenic
1077409126 11:2395344-2395366 CCCCCACCCCGCCCCGCCCCAGG - Intronic
1077471452 11:2762802-2762824 CCCCCACCCCACCCCGTCCACGG + Intronic
1077508403 11:2942766-2942788 CACCCACCCCACCCCGCTTGGGG - Intergenic
1077792902 11:5461049-5461071 CCCCCATGCCACCATGCCGTAGG - Intronic
1078056540 11:8013936-8013958 CCCCCACCCCACCCCATCTTAGG + Intergenic
1078986840 11:16605721-16605743 CCCCCACCCCACCCCCATTTCGG - Intronic
1079102655 11:17551523-17551545 CCCCCACCCCAACCTTCCTTTGG - Intronic
1079361937 11:19777095-19777117 CCCCCCCCCCACCCCGCCCTCGG + Intronic
1080616035 11:33945651-33945673 CCCCCACCCCACACTGCCTAGGG + Intergenic
1080647069 11:34195071-34195093 CCCCCACTCCCCCCCCCCGCCGG - Intronic
1081647381 11:44799305-44799327 CCCGCACCCCACCCCAACTTCGG + Intronic
1082559873 11:54605686-54605708 CCCCCACCCCACCAAGTCGTGGG + Intergenic
1082784881 11:57311368-57311390 CCCCGCCCCCAACCCGCCTTGGG + Intronic
1083011218 11:59401519-59401541 CACCTTCCCCACCCCGCTGTGGG + Intergenic
1083430281 11:62610842-62610864 CCCTCAACCCACCCCGCCCCAGG - Intronic
1083659450 11:64245465-64245487 TCCCCCCCCCACCCCGCTTTGGG - Intronic
1083821447 11:65173401-65173423 CCCCCTCCCCACCCCAACCTTGG - Intergenic
1083955627 11:65981466-65981488 CCCCAACCCCTCCCAGCCCTGGG - Intergenic
1084195788 11:67523184-67523206 CCCCAACCCCGCCCGGCCCTCGG + Intronic
1084285611 11:68128657-68128679 CCCCCACCCCCGCCCCCCCTTGG + Intergenic
1084757438 11:71248800-71248822 CCCCCACCCCACCCCACGCTGGG + Intronic
1085016409 11:73177004-73177026 CCCCCACACCACCCTGCCTCAGG - Intergenic
1085571256 11:77559753-77559775 CCTCCACCCCACCACCCCTTGGG - Intronic
1087076213 11:94129092-94129114 GCCCCGCCCCGCCCCGCCGGCGG + Exonic
1088788667 11:113204848-113204870 CCCCCACCCCACTGAGCCCTGGG - Intronic
1089272994 11:117314889-117314911 CCCCCACCCCACACCTCCCCAGG - Intronic
1089311329 11:117560034-117560056 CCCCCACCCCTCCCAGCAGCCGG - Intronic
1089402385 11:118171744-118171766 CCCCCTCCCCACCCTGCAGCGGG + Intronic
1089543571 11:119206003-119206025 GCCCCGCCCCGCCCCGGCGTAGG + Intergenic
1089556159 11:119316944-119316966 CCCCGACCCCGCCGCGCCGCTGG + Intronic
1089579875 11:119474958-119474980 CCCCCACCCCACCTCTCCTGGGG + Intergenic
1089625219 11:119746831-119746853 CCCCCCCCCCCCCCCACCCTTGG - Intergenic
1089632849 11:119794309-119794331 AGCCCAGCCCTCCCCGCCGTTGG + Intergenic
1091108549 11:132944176-132944198 CCCCCACCCCGCCCCTCTGTAGG - Intronic
1091124674 11:133083437-133083459 ACCCCACCCCACCCCAGCCTGGG + Intronic
1202816582 11_KI270721v1_random:49145-49167 CCCCCTCCCCATCCAGCTGTGGG - Intergenic
1091725803 12:2845747-2845769 CCCCCACCCCACCCCACCAAAGG + Intronic
1091813848 12:3421412-3421434 CCACCACCCCACCCCCCGGCAGG - Intronic
1092108922 12:5945349-5945371 CCCCCATCCCTCCCGGCCGCCGG + Intronic
1093172377 12:15874861-15874883 TCCCCCACCCACCCCGCTGTGGG + Intronic
1094025936 12:25959281-25959303 CCCCCACCCTGCCCCGCCGCGGG + Intronic
1095690597 12:45084259-45084281 CCACCACCCCACCCCCCAGTAGG + Intergenic
1096489687 12:52006886-52006908 CCCCAACCCCGCCCCGCTCTCGG + Intergenic
1096575282 12:52548943-52548965 GCCCTACCCCACCCCACCCTGGG + Intronic
1096972342 12:55677704-55677726 CCCCCACCCCACCCCACGACAGG - Intergenic
1097053670 12:56237994-56238016 GCCCCACCCCTCCCCTCCCTGGG - Exonic
1097276810 12:57819332-57819354 CCACCACCACACCCAGCCCTGGG - Intergenic
1097664164 12:62461362-62461384 GCCTCGCCCCACCCCACCGTGGG - Intergenic
1097664787 12:62466713-62466735 CCCCAGCCCCGCCCCGCCGACGG + Intergenic
1097889939 12:64767784-64767806 CCCCCTCCCCCCCCCCCCGCCGG - Intergenic
1099191425 12:79565226-79565248 CCCCACCCCCGCCCCGCCGTGGG + Intergenic
1099228125 12:79993312-79993334 CTCCCCCCTCTCCCCGCCGTGGG - Intergenic
1099285262 12:80708453-80708475 CCCCCACCCCACCCCAACCCCGG + Intronic
1099979656 12:89583783-89583805 CCCCCCCCCCCCCCCGCCAAAGG - Intergenic
1100142378 12:91634225-91634247 CCCTACCCCCACCCCGCCGTGGG + Intergenic
1100605592 12:96149678-96149700 GACCCCCACCACCCCGCCGTGGG + Intergenic
1101429644 12:104616436-104616458 CCCCCACCCCAGCCTGCCAAAGG + Intronic
1101664107 12:106793918-106793940 CCCCACCCCCACCCCGCCCATGG - Intronic
1101786783 12:107891240-107891262 TCCCCACCCCAACCCTCAGTAGG + Intergenic
1101810784 12:108106025-108106047 ACCCCACCCCACCCAGCCTCTGG - Intergenic
1101965853 12:109281499-109281521 CCGCTCCCCCACCCCGCCATGGG - Exonic
1102423925 12:112825553-112825575 CCCCGACCCCACCCCTCTGAAGG - Intronic
1102506853 12:113389285-113389307 GCCCCACCCCACCCCACCCCAGG + Exonic
1102586039 12:113923708-113923730 CCCCCACCCCTCCCAGCCTCGGG + Intronic
1103188605 12:118981757-118981779 CTCCCACCCCACCCCTCTCTGGG + Exonic
1103364057 12:120369449-120369471 CCCCCCACCCACCCCGGCGCGGG + Intergenic
1103488255 12:121296905-121296927 TCCCCACCCCTCCCCGGCGCAGG - Intronic
1103851607 12:123937147-123937169 CCACCACGCCACCCCGCCGCAGG - Exonic
1103910450 12:124349313-124349335 CCCCCGCCCCACCCCTCAGAGGG + Intronic
1103928692 12:124437722-124437744 CCCCCACCCCCACCCACCCTGGG + Intronic
1104030859 12:125065252-125065274 CCCCCACGCCCCCCGGCCGCGGG + Intergenic
1104049754 12:125187170-125187192 CCCCCTCCCCGCCCTGCCTTGGG + Intronic
1104373914 12:128247521-128247543 CCCCCACCCCCGACCCCCGTGGG + Intergenic
1104946410 12:132416791-132416813 CTCCCTCCCCACCCCACAGTGGG + Intergenic
1105465171 13:20633350-20633372 CCCCCACCCCAGCCAGCCATTGG + Intronic
1106226296 13:27789689-27789711 CTCCCACCCCGCCCCGCTCTGGG + Intergenic
1107881072 13:44832389-44832411 TCCCCAACCCACCCAGCCCTGGG - Intergenic
1108572824 13:51767774-51767796 CCCCCCCCCCCCCCCGCCCCAGG - Intergenic
1108782909 13:53858416-53858438 CCCCCACCCCTCCCCACCCTTGG + Intergenic
1110251431 13:73384963-73384985 ACCCCACCCCACCCCGCAACTGG - Intergenic
1110983896 13:81939189-81939211 CCCTCACCCTACCCCCCAGTAGG - Intergenic
1111842045 13:93461659-93461681 CCCCCCCCCAACCCCCCCGCCGG - Intronic
1111997160 13:95176216-95176238 CCCCCCCCCCCCCCTGCCCTCGG - Intronic
1112494546 13:99894729-99894751 CCCCCCCCCCCCCCCGCCTCAGG - Exonic
1113484207 13:110642574-110642596 CCCCCTCCCCACCCCGTGGTTGG + Intronic
1113681167 13:112246094-112246116 CCCCCACCCCCACCCCCCGCTGG + Intergenic
1113880255 13:113621350-113621372 CCCACACCCCACCCCACGGCTGG - Intronic
1115498629 14:34030063-34030085 CCCCAACCCCACCTCCCAGTGGG - Intronic
1115753651 14:36514015-36514037 CCCCCACTCCTCTCAGCCGTTGG + Intergenic
1115850179 14:37584453-37584475 CCCCCTCCCCACCGGGCCCTGGG - Intergenic
1116325853 14:43533326-43533348 CCGCCTCCCCACCCCACTGTGGG + Intergenic
1116614641 14:47119178-47119200 CCCCCCCCCCACCCCGTAGCTGG + Intronic
1116941744 14:50797854-50797876 CCCCTTCCCCACCCCTCCATAGG - Intronic
1117063913 14:51989764-51989786 CCCGCACCCCACCTCCCCGTCGG + Intronic
1117065653 14:52011112-52011134 CCCCCTGCCCACCCGACCGTTGG - Intronic
1117068461 14:52034011-52034033 CCCCACCCCCACCCCACCATTGG + Intronic
1117145573 14:52833852-52833874 CCCCCACCCCTCCCCCCTGCCGG + Intergenic
1117604446 14:57413116-57413138 CCCCCACCCCATCCCACCCTTGG + Exonic
1117690066 14:58297827-58297849 CCTTCTCCCCACCCCGCCGCAGG + Intronic
1117953738 14:61107203-61107225 CCGGCACCCCACCCCGGTGTTGG + Intergenic
1120216263 14:81683525-81683547 CACCCACCCCACCCCGCGGGGGG - Intergenic
1120759641 14:88274044-88274066 CCCACCCCCCACCCTGCCCTAGG + Intronic
1120781460 14:88489860-88489882 CCCCTACCAAACCCCGCCTTAGG + Intronic
1122181120 14:99955563-99955585 CCCCCACCCTACCCCCGCATTGG - Intergenic
1122705011 14:103615436-103615458 CCCCCACCCCAGCCCCCCAGTGG + Intronic
1122772667 14:104104282-104104304 CCCCCACCCCACCGCCCCACAGG + Exonic
1122957359 14:105076911-105076933 CCCTCATCCTCCCCCGCCGTGGG - Intergenic
1123056574 14:105573835-105573857 TGCCCACCACACCCCGCCTTGGG + Intergenic
1123081637 14:105697950-105697972 TGCCCACCACACCCCGCCTTGGG - Intergenic
1123204030 14:106694768-106694790 CCCCCCCCCCCCCCCCCCGGTGG + Intergenic
1123505983 15:20941608-20941630 CCCCACCCGCACCCCGCCATGGG - Intergenic
1123534832 15:21174909-21174931 CCCCCCCCCCATCCCGCCCGGGG + Intergenic
1123563215 15:21515315-21515337 CCCCACCCGCACCCCGCCATGGG - Intergenic
1123599464 15:21952598-21952620 CCCCACCCGCACCCCGCCATGGG - Intergenic
1125522788 15:40357502-40357524 CCCCCACCCCACCTCAGCCTGGG - Intergenic
1125592174 15:40861644-40861666 CCCCCACCCCACCCAGCATTAGG + Intergenic
1125665429 15:41426700-41426722 CCCCCGCCCCCCCCCCCCGCCGG + Intronic
1125719059 15:41836391-41836413 CCTCCACCCCAGCCAGCCCTGGG - Intronic
1125797235 15:42411681-42411703 ACCCCCCCCCCCCCCGCCCTAGG - Intronic
1126346291 15:47697775-47697797 CCCCCACTTCCCCCCGCCTTAGG + Intronic
1127371744 15:58347930-58347952 CCCCCACCCCACCCCACAACAGG - Intronic
1127594147 15:60461091-60461113 CCCCCACCCCACCCATCCCTAGG - Intronic
1128028621 15:64460709-64460731 CCCCCACCCCACCCCGGCTCCGG - Intergenic
1128301240 15:66567577-66567599 CCCCCACCCCACCCACCCCCTGG - Intergenic
1128502025 15:68233296-68233318 CACCCCCCCCACCCCCCCGTAGG - Intronic
1128509087 15:68302574-68302596 CACCCATCCCACCCCTCCATTGG - Exonic
1128880866 15:71241737-71241759 CCCCCGCCCCACCCCACCTCAGG + Intronic
1129158236 15:73732273-73732295 CCACGCCCCCAACCCGCCGTCGG - Intergenic
1129221759 15:74135323-74135345 CCCGCAGCCCGCCCCACCGTGGG + Exonic
1129334123 15:74842507-74842529 CCCCCACCCCGCCCCTCCCCGGG + Intronic
1129423996 15:75451713-75451735 CCCCGACCCCGCCCCGCAGAGGG + Intronic
1129774124 15:78223272-78223294 CCCCCACCCCACCCCCCAACAGG - Intronic
1129817161 15:78565377-78565399 TCCCCACCCCGCCCCGCCTCTGG - Intergenic
1129901086 15:79149898-79149920 CCACCACCCCACCCCACCTAGGG - Intergenic
1130224325 15:82045925-82045947 CCCCCACCCCACCCGCCAGCAGG - Exonic
1130531241 15:84748853-84748875 CCGCCACCCCACCCCGCCCCCGG + Intronic
1132115884 15:99136227-99136249 CCCCCACCCCACCCCACCCCAGG - Intergenic
1132285247 15:100657948-100657970 CCCCCTCCCCACCCCACAGTGGG + Intergenic
1202971567 15_KI270727v1_random:242449-242471 CCCCACCCGCACCCCGCCATGGG - Intergenic
1132549685 16:549214-549236 CACCCGCCCCACCCCGGCCTTGG - Intronic
1132553594 16:563554-563576 CACCCACCCCAGACCGCCCTGGG + Exonic
1132557469 16:578953-578975 CCCCCTCCCCACCGCCCCCTGGG + Intronic
1132575036 16:660316-660338 CCCCCACCCCTGCCCTCCGCTGG + Intronic
1132687697 16:1169155-1169177 CCCCACCCCCACCCCGCCGCAGG - Intronic
1132715607 16:1288631-1288653 CCCCCACTCCCACCCGCCGAGGG + Intergenic
1132717765 16:1300747-1300769 CCCTCACCCCACCCAGCAGGAGG - Intergenic
1132982061 16:2743295-2743317 CCCCCACCCCAGCCCTCTGTGGG + Intergenic
1133102195 16:3486302-3486324 CCCCCACCCCACCCCTGCATCGG - Exonic
1134834157 16:17347312-17347334 TCCCCACCCCACCATGCCCTAGG + Intronic
1135321867 16:21502543-21502565 CCCCCCCCCCCCCCCACCGCAGG - Intergenic
1135565063 16:23505678-23505700 CCCCCACCCCACCCCACCCCAGG + Intronic
1135607259 16:23835740-23835762 CCCCCACCCCACCCCGTCCTCGG - Intergenic
1136147915 16:28326646-28326668 ACCCCACCCCACCCCACCCCTGG + Intergenic
1136293422 16:29289223-29289245 CCCCCACCCCACCCAGTGGTTGG + Intergenic
1136677083 16:31920487-31920509 CCCCCAAGCCACCCCACCGAGGG + Intergenic
1136777299 16:32878778-32878800 TCCCCACCCCACCCCTCCAGGGG - Intergenic
1136893326 16:33982735-33982757 TCCCCACCCCACCCCTCCAGGGG + Intergenic
1137456884 16:48624141-48624163 CCCCCCCCCCCCCCCGCCCAAGG - Intergenic
1137558953 16:49490861-49490883 CCCCCACCCCCCACCCCCTTCGG - Exonic
1137611481 16:49821243-49821265 CCCCCGCCCCACCACCCTGTGGG - Intronic
1138037754 16:53625418-53625440 CCCCCACCCCACCCCCCAGACGG - Intronic
1138245901 16:55467144-55467166 CCCCAACCCCACCCCACCTAAGG + Intronic
1138349272 16:56337941-56337963 CCCCCACCCCACGCCTCTGAAGG + Intronic
1138515610 16:57534152-57534174 CCCCAACCCCACCCCCACCTGGG + Intronic
1138558522 16:57786701-57786723 CCCCAACCCCAGCCTGCCGAGGG - Intronic
1138688813 16:58749129-58749151 TCTCCTCCCCACCCCGCCGTGGG + Intergenic
1139274401 16:65714177-65714199 TTCCCACCCCACCCAGCCCTAGG + Intergenic
1139468314 16:67165638-67165660 CCCGCTCCCCGCCCGGCCGTAGG - Intronic
1139551179 16:67673976-67673998 CCCCCACCCCCCGCCGCCTCTGG + Intergenic
1139896230 16:70289752-70289774 CCCCCGCCCCCCCCCGCCCCCGG + Intronic
1140163529 16:72525454-72525476 GCCCCACCCCACCCCACGATAGG + Intergenic
1140256889 16:73345389-73345411 CCCCCACCCCACCCCCCGACAGG + Intergenic
1140736511 16:77902720-77902742 CACCCCCCCCACCCCCCCATCGG - Intronic
1141054519 16:80803705-80803727 CCCCCGCCCCACACCCCCGCCGG + Intronic
1141063425 16:80895760-80895782 GCGCCACCGCACCCAGCCGTGGG - Intergenic
1141289066 16:82700960-82700982 CCCCCCCCCCCCCCCGCCCCGGG + Intronic
1141644155 16:85358468-85358490 CCCCCAGCCCAGCCCGCCCCTGG + Intronic
1141687245 16:85577431-85577453 CCACCACCCCACCCAGCAGCTGG + Intergenic
1141788760 16:86218769-86218791 ACCCCACCCCACCTACCCGTGGG + Intergenic
1142080074 16:88144199-88144221 CGCCCTCCCCACCACGCCTTTGG - Intergenic
1142099304 16:88263229-88263251 CCCCCACCCCACCCAGTTGTTGG + Intergenic
1142223201 16:88865247-88865269 CCTCCACCCCACACCCCCGCTGG + Intronic
1142234364 16:88914962-88914984 CCCCCACCCCGCCCCGGCAGCGG - Intronic
1142292691 16:89200197-89200219 CCCCCACCCCAGCCGGCCAAGGG + Intronic
1203079713 16_KI270728v1_random:1140887-1140909 TCCCCACCCCACCCCTCCAGGGG - Intergenic
1142550065 17:732815-732837 ACCGCACCCCACCCGGCCGCGGG + Intronic
1142671722 17:1490821-1490843 CCCCCACCCCTCCCCCCAGGAGG + Intronic
1142699362 17:1649832-1649854 CCCCCACCCCACCCTCCACTGGG + Exonic
1142927684 17:3255375-3255397 CCCCCACCCCACCCTGCGGCAGG - Intergenic
1143023021 17:3926366-3926388 CCTCCACCCCACCCCTCAGATGG + Intronic
1143125711 17:4639976-4639998 CCCCCACCCCACCCCGCCCGAGG + Intronic
1143297835 17:5884586-5884608 ACCCCACCCCACCCCGCCCAAGG + Intronic
1143372979 17:6451875-6451897 CCCCCCCCCCCGCCCGCCGATGG + Exonic
1143402763 17:6656846-6656868 CCTCCACCCCACCCCGCCCGAGG - Intergenic
1143518932 17:7434776-7434798 CCCCCACCCCACCCAGGCAGGGG + Intergenic
1143683694 17:8496596-8496618 TCCCCTCCCTTCCCCGCCGTAGG + Intronic
1143895545 17:10133699-10133721 GCCCCACCCCACCCAGCCCCTGG + Intronic
1143998033 17:11025265-11025287 CCCCAAACCCACCTCACCGTTGG - Intergenic
1144735661 17:17553954-17553976 CCCCCACCCCACCCCTGGCTGGG - Intronic
1144950169 17:18989644-18989666 CCCCCGCCCCAGCCCCCCGTCGG - Intronic
1145230891 17:21172434-21172456 ACCCCACCCCACCCCACCCCCGG - Intronic
1145237038 17:21215333-21215355 CCCCCTTCCCACCCCGCCGCAGG + Intergenic
1145759208 17:27416374-27416396 CCTCCACCCCATCCCGCCCCAGG - Intergenic
1145963540 17:28901454-28901476 CCGCCACCCCACCCCCACGCAGG + Intronic
1145998244 17:29116728-29116750 CCCCCCCCCCCCCCCCCCGCCGG + Intronic
1145998397 17:29117431-29117453 ACCCTACCCCACCCCACGGTGGG + Intronic
1146176183 17:30667801-30667823 CCCCCACCCCACCCCGCAGGCGG - Intergenic
1146201323 17:30861195-30861217 CCCACCCCCCTCCCCGCCCTTGG + Intronic
1146349641 17:32083912-32083934 CCCCCACCCCACCCCGCAGGCGG - Intergenic
1146539786 17:33684310-33684332 CCCCCTCCCCACCCCAGGGTCGG - Intronic
1146956717 17:36940268-36940290 CCCCACCCCCACCCCCCCGCAGG + Exonic
1147179479 17:38675034-38675056 CCCGGACCCCACCCCTCCGGCGG + Exonic
1147312849 17:39605352-39605374 CCCCCATCCTACCCCGGCGCCGG - Exonic
1147453820 17:40522096-40522118 CCCCCACCCGCCCCCGCCGATGG - Intergenic
1147690238 17:42310356-42310378 CCCCCACCCCACCCCAAGCTGGG - Intronic
1148080688 17:44966536-44966558 CCTCCACCCAGCCCCGCCCTGGG - Intronic
1148084956 17:44988235-44988257 CCCCCATCCCAGGCCCCCGTGGG + Intergenic
1148115302 17:45171813-45171835 CCCCCACCTCACCCCGCTGGAGG + Intergenic
1148463815 17:47852583-47852605 CCCCTACTCCCCCCCGCCATTGG + Intronic
1148560321 17:48602367-48602389 CCCCCACCCCACCAAGGCGCGGG - Intronic
1148649186 17:49237475-49237497 ACCCCACCCCACCCCATCCTGGG + Intergenic
1148674149 17:49435297-49435319 CCCCCACCCCACCCCATCTAGGG + Intronic
1148731041 17:49836820-49836842 GCCCCACCCCACCCAGCCACCGG - Intergenic
1148826466 17:50397628-50397650 CTCCAACCCCACCCCTCCGGCGG - Intergenic
1148830174 17:50426114-50426136 GCCCCGCCCCGCCCCGCCGGCGG + Intergenic
1149356561 17:55845602-55845624 CCCCTCCCCCACCCCGCCGTGGG + Intergenic
1149884502 17:60327491-60327513 CGCCCACCCCACCCCACCTCAGG + Intronic
1149992854 17:61392432-61392454 CCCCCCACCCGCCCCACCGTGGG - Exonic
1149993732 17:61396521-61396543 CCCCCACCCCAACCAGACCTGGG + Intergenic
1150004828 17:61463131-61463153 CCCCCACCCCACCCCAGAGTGGG + Intronic
1150620470 17:66804069-66804091 CCCCCAGCCCTCCCCGCAGTGGG + Exonic
1151438471 17:74113397-74113419 CCCGCCCCCGCCCCCGCCGTGGG - Intergenic
1151712342 17:75813885-75813907 CCACCCCCCCACCCTGCTGTGGG - Intronic
1151876398 17:76869933-76869955 CCCCCTCCCCACCCCGCTGCGGG - Intronic
1151940367 17:77288117-77288139 CTCCTACCCCACCCCGGCCTGGG + Intronic
1152107999 17:78341976-78341998 CCCCGCCCCCACCCCGCCCGCGG - Intergenic
1152109510 17:78349893-78349915 CCCCCACTCCACCCCACGCTAGG - Intergenic
1152456650 17:80421006-80421028 GCCCCACCCCACCCCTCCATGGG - Intronic
1152507745 17:80762359-80762381 CCCTCACCCCAGCCCCCAGTGGG - Intronic
1152628541 17:81399427-81399449 CCCCCACCCCCCACCCCCGCCGG - Intronic
1152861518 17:82698957-82698979 CCCCCACCCCGCCCCGCCATTGG - Intergenic
1152902563 17:82951791-82951813 CCCCCACCCCACCCCTCCTCAGG - Intronic
1152990885 18:362574-362596 GCCCACCCCCACCCCGCCATGGG - Intronic
1153146843 18:2043036-2043058 CCCCAACCCCACCCCCCAATAGG - Intergenic
1153574293 18:6504986-6505008 CCCCCACCCTGCCCTGCCCTTGG - Intergenic
1154172215 18:12060536-12060558 CCCCCACCGCCCCCCGCAGTGGG - Intergenic
1154210916 18:12377574-12377596 CGCCCCCCACACCCCTCCGTCGG - Intergenic
1154996762 18:21647613-21647635 CCCCCACCCCACCCCACCCCTGG + Intergenic
1154999778 18:21674909-21674931 CCTCCACCCCACCCCACTGTGGG - Intronic
1155145596 18:23080883-23080905 CCCCCACCTCAACCTGCCTTTGG + Intergenic
1155654286 18:28176914-28176936 CGCCCGCCCCACCCCGCCCGTGG + Intronic
1156370745 18:36469417-36469439 CCCCCACCCCACCTCCCAGTTGG - Intronic
1156474206 18:37395328-37395350 CACACAGCCCAGCCCGCCGTGGG - Intronic
1156558031 18:38089567-38089589 CCCCCACCCCACCCCACCGCTGG + Intergenic
1157281346 18:46348188-46348210 CCCTCACCCCACCCCTTCCTGGG - Intronic
1157513844 18:48297034-48297056 CCCCCACCCCACCCCGTCTGTGG + Intronic
1157563547 18:48664574-48664596 CCCCTGCCCCACCCCACCCTGGG - Intronic
1157731783 18:50010380-50010402 CACCCAGCCCACCCCATCGTGGG + Intronic
1159040803 18:63320892-63320914 CCCCCACCGCCCCCAGCAGTGGG + Intergenic
1160089466 18:75812751-75812773 CCCCCACCCCAAGCCCCCTTGGG + Intergenic
1160518229 18:79490092-79490114 CCCCGCCCCCGCCCCCCCGTGGG + Intronic
1160814325 19:1028245-1028267 ACCCCACCCCACCCCGTCTCCGG - Intronic
1160827908 19:1089292-1089314 CCCAGACCCCACCCGACCGTAGG - Intronic
1161154691 19:2726584-2726606 ACCCCCCCCCCCCCCCCCGTGGG - Intronic
1161160828 19:2761121-2761143 CCCCCACCCCACCCTGGCGTGGG - Intronic
1161161429 19:2763646-2763668 CACTCACCCCATCCTGCCGTAGG + Exonic
1161232247 19:3180145-3180167 CAACCACCCCACCTCCCCGTAGG + Exonic
1161266361 19:3366522-3366544 CCCCCCCCCCGCCCCGCGGCCGG - Intronic
1161305330 19:3564210-3564232 TCCCCACCCCACCCCGAGGCTGG - Intronic
1161802394 19:6423743-6423765 CCCCCACCCCTCCAGGCCATGGG + Intronic
1161852717 19:6746035-6746057 CCCCCACCCCTCTCCCCCCTGGG + Intronic
1161977193 19:7613199-7613221 CCCCCACCCGCCCCCGCCCCAGG - Intronic
1162293108 19:9793201-9793223 CCCCCACCCCAAGCCGCCGCCGG - Intergenic
1162472629 19:10881602-10881624 CCCCCACCCCAGCCCTCCAGGGG - Intronic
1162524623 19:11200307-11200329 CACCCACCCCACCCGGCCTCAGG - Exonic
1162798405 19:13098266-13098288 CCCCCACCCCACCCACCCTCGGG + Intronic
1162806235 19:13139286-13139308 CACCCACCCCACCCCACAGCAGG + Exonic
1162909114 19:13840024-13840046 CCCCCACCCCAGCCCTGGGTGGG - Intergenic
1162982638 19:14249105-14249127 CCCCCACCCCACCCCGCAGGTGG + Intergenic
1163075521 19:14887484-14887506 CCCCCACCCCACCCCCCAACAGG + Intergenic
1163135796 19:15310363-15310385 CCCCCCCCCCCCCCCCCCGAAGG + Intronic
1163297915 19:16424322-16424344 CTCCCACCCCACCCCACCAGGGG + Intronic
1163498797 19:17663294-17663316 CCCCCACCCCACCCCAATGACGG + Intronic
1163548106 19:17951071-17951093 CCCCCTCCCCAGCCCCCCGGCGG - Intergenic
1164201679 19:23024351-23024373 CCCCCCCCCCCCCCGCCCGTAGG + Intergenic
1164686029 19:30167396-30167418 CTCCAACCCCACCCTGCAGTGGG - Intergenic
1164956401 19:32390520-32390542 CTCCCACCCCACCCCACCACAGG + Intergenic
1165413664 19:35677912-35677934 CCCCCAGCCCACCCAGCCTGTGG - Intronic
1165511312 19:36268221-36268243 CCCCCACCCCGCCACGGGGTAGG - Intergenic
1165511863 19:36270754-36270776 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165512415 19:36273255-36273277 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165512962 19:36275796-36275818 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165513518 19:36278351-36278373 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165514068 19:36280885-36280907 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165514620 19:36283422-36283444 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165515172 19:36285955-36285977 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165515722 19:36288491-36288513 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165516273 19:36291028-36291050 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165516825 19:36293554-36293576 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165517378 19:36296077-36296099 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165517930 19:36298612-36298634 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165518481 19:36301147-36301169 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165519030 19:36303679-36303701 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165519580 19:36306194-36306216 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165520130 19:36308722-36308744 CCCCACCCCCAGCCCGCCGCCGG - Intergenic
1165623938 19:37269859-37269881 CCCCACCCCCAGCCCGCCGCCGG + Intergenic
1165624484 19:37272400-37272422 CCCCACCCCCAGCCCGCCGCCGG + Intergenic
1165625027 19:37274927-37274949 CCCCACCCCCAGCCCGCCGCCGG + Intergenic
1165626101 19:37279990-37280012 CCCCACCCCCAGCCCGCCGCCGG + Intergenic
1165626642 19:37282517-37282539 CCCCACCCCCAGCCCGCCGCCGG + Intergenic
1165627182 19:37285038-37285060 CCCCACCCCCAGCCCGCCGCCGG + Intergenic
1165628261 19:37290090-37290112 CCCCACCCCCAGCCCGCCGCCGG + Intergenic
1165628801 19:37292615-37292637 CCCCACCCCCAGCCCGCCGCCGG + Intergenic
1165629343 19:37295141-37295163 CCCCACCCCCAGCCCGCCGCCGG + Intergenic
1165629884 19:37297666-37297688 CCCCACCCCCAGCCCGCCGCCGG + Intergenic
1165630427 19:37300194-37300216 CCCCACCCCCAGCCCGCCGCCGG + Intergenic
1165630964 19:37302732-37302754 CCCCACCCCCAGCCCGCCGCCGG + Intergenic
1165949317 19:39465053-39465075 CCCCCATGCCACCCCGCCCCGGG - Intronic
1165955301 19:39498848-39498870 CGCCCCCCCCGCCCCGCCCTTGG + Intergenic
1166536985 19:43580620-43580642 ACCCCACCCCACCCCACCCACGG - Intronic
1166666346 19:44682674-44682696 ACCCCTCCCCACCCCGGCTTCGG - Intronic
1166691048 19:44821308-44821330 CCCCCCCCTCACCCCGCCCCTGG + Exonic
1166732541 19:45067269-45067291 CCCCAACCGCACCCCACCCTGGG - Intronic
1166752389 19:45170487-45170509 CCCCCAGCTCACCCCTCCGGGGG - Intronic
1166944908 19:46390609-46390631 GCCCCACCCCACCCCGAGGACGG - Exonic
1166975319 19:46602027-46602049 CCCCCACCCTCCCCCACCCTCGG - Intronic
1167148338 19:47695343-47695365 CCCCCACCCCACCCACCCCCAGG + Exonic
1167290938 19:48624862-48624884 CCCCCACCCCCCACCGCCTGTGG - Intronic
1167455039 19:49593446-49593468 CCCCCATCCCGCCCCGCTTTGGG + Intronic
1167608324 19:50493495-50493517 CCCCCACCCCACCCTGACCTGGG + Intergenic
1167622744 19:50568327-50568349 CCCCCACCCCACCCCCCCCCAGG + Intergenic
1167960554 19:53101693-53101715 CCCCCACCCTACCCCATCCTCGG + Intronic
1168224820 19:54987137-54987159 CCCCCACCCCACCCCGCCGTCGG + Intronic
1168272630 19:55258481-55258503 GCCCCCCCCCGCCCCGCCGCCGG + Exonic
1168713448 19:58514368-58514390 ACCCCACCCCACCCCCACCTGGG + Intronic
925142044 2:1557454-1557476 GCCCCACCCCACCCCCACGCAGG - Intergenic
925167870 2:1729552-1729574 CCCCTCCCCCACCCTGCTGTAGG - Intronic
925228205 2:2205105-2205127 CCCCCACCCCACCCCACAACAGG - Intronic
925311240 2:2883755-2883777 CCCCCACCGCACCCAGCCAATGG + Intergenic
925868261 2:8247548-8247570 CCCCCAGCCCACCCTGCCCTGGG + Intergenic
926094628 2:10073212-10073234 CCCCCCCCCCCCCCGGCTGTGGG + Intronic
926123224 2:10256019-10256041 CCCCCACCCCACCCCCAATTTGG - Intergenic
927265941 2:21151240-21151262 CCCCCACCCCACCCCCCAACAGG + Intergenic
927997261 2:27494962-27494984 CCCCTACCCCATCCCGGCGCGGG + Exonic
928164995 2:28964636-28964658 CCCCCACCCAACCCCCCAGCAGG + Intronic
928650616 2:33400179-33400201 TGCCCACCCCACCCCGCCCCTGG + Intergenic
929151232 2:38750916-38750938 CCCCCCTCCCCCCCCGCCCTCGG - Intronic
929227528 2:39525954-39525976 CCCCCACCCCACCCGCCAGTGGG - Intergenic
929390547 2:41464217-41464239 ACCCCACCCCACCCCTACCTAGG + Intergenic
930311727 2:49750134-49750156 CCCCGACCCCACCCCGCAACAGG - Intergenic
930812126 2:55553612-55553634 CCCCCACACCACCCAGCTCTTGG + Intronic
931234756 2:60403868-60403890 ACCCCACCCCACCCCACCCCAGG + Intergenic
932420916 2:71600874-71600896 CCCCCACCCCACTCCTGCCTGGG - Intronic
932764558 2:74461659-74461681 ACCCCACCTCATCCCGCCTTGGG - Exonic
932776267 2:74530016-74530038 CCTGCACCCCGCCCCGCCCTCGG - Exonic
932893194 2:75613343-75613365 CCCCCCCCCCCCCCCCCCGCAGG - Intergenic
935046711 2:99489778-99489800 CCCCTCCCCCACCCCGCCGCCGG + Intronic
935263583 2:101375698-101375720 GCCGCACCCCACCCCGTCCTGGG - Intronic
935581292 2:104758115-104758137 ACCCCACCCCACCCCACCCAGGG + Intergenic
935695685 2:105768963-105768985 CCCCCACCCCTCCCAGAGGTTGG + Intronic
936007674 2:108905518-108905540 CCACCCCCACACCCCACCGTAGG - Intronic
936167718 2:110138167-110138189 CCCCCACCCCACCCCACAACAGG - Intronic
937161433 2:119766120-119766142 CCCCCTCCCCACCCTGCCCCAGG + Intronic
937208630 2:120253003-120253025 CCCGCGCCCCACCCCGCCCGGGG - Intronic
937222130 2:120347708-120347730 CCCCCACCCCACCAGGCAGCAGG + Intronic
937466905 2:122141042-122141064 CCCCCGCCCCACCCCACGATAGG + Intergenic
937901757 2:127025192-127025214 GCCCCTCCCCAACCGGCCGTTGG + Intergenic
937917448 2:127106118-127106140 CCAGCTCCCCACCCGGCCGTGGG + Intronic
938099199 2:128486622-128486644 CCCCCCCCCCACCCCGCCCCCGG - Intergenic
938418424 2:131123779-131123801 CCCCCCCCGCCCCCCGCCCTCGG + Intronic
938500060 2:131827664-131827686 CGCCCACGCCACCCAGCCATGGG - Intergenic
938639883 2:133266943-133266965 CCCCCTCCCCTCCCCTCCGCCGG + Intronic
939275168 2:139990781-139990803 CCCCCTCCCCCCGCCTCCGTGGG - Intergenic
940033484 2:149289098-149289120 CCACCACCCCACCCCACCCCTGG - Intergenic
940087883 2:149881548-149881570 CCCCCACCCCACCCCACCACAGG - Intergenic
940866186 2:158819790-158819812 CCCCCACCCCACCCCACCCCGGG + Intronic
940875434 2:158893122-158893144 CCCCCACCCCATCCCTCCTTGGG - Intergenic
940986779 2:160058832-160058854 CCCCCACCCCACCACCCCATTGG - Intronic
941211969 2:162651362-162651384 CTCCCACCCCACCCCCAAGTAGG + Intronic
941806624 2:169716824-169716846 CCACCCCCCCACCCCGCCCCAGG + Intronic
941949568 2:171139807-171139829 ACCCCACCCCACCCCACCCCTGG - Intronic
943185191 2:184598377-184598399 TCCCCCGCCCACCCCGCCGCCGG - Exonic
943331859 2:186569479-186569501 CCCCCACCCCACCCCCCGAGAGG - Intergenic
943765268 2:191654220-191654242 CCCCCACCCCGCCCAGCTGATGG - Intergenic
943954978 2:194176637-194176659 CCACCCCCCCACCCCCCCGTGGG + Intergenic
944834293 2:203562833-203562855 CCCCCACCCCAACCCAAGGTTGG - Intergenic
945431628 2:209771897-209771919 CCCCCACCCCTCCCCGCGCGTGG - Intergenic
945870246 2:215219335-215219357 GCCCCCCCCAACCCCTCCGTGGG + Intergenic
946029295 2:216692213-216692235 CTCCGACTCCACCCCGCCGAAGG - Intronic
946151786 2:217778763-217778785 TCCCCACCCCACCCCACCCCCGG + Intergenic
946247365 2:218395360-218395382 CCCTCACCCCACCCACCCTTGGG - Exonic
946613068 2:221480047-221480069 ACCCCACCCCACCCCACCCCCGG + Intronic
946748239 2:222866763-222866785 CCCCCCCCCCCCCCCGCCCCGGG + Intronic
946767457 2:223053469-223053491 CCCCCACCCCACCCCGAATCAGG - Exonic
947103828 2:226648285-226648307 TCCCCTCCCCACCCCACCATGGG + Intergenic
947948294 2:234125294-234125316 CCCCCACCCCACCCTGCCCCTGG - Intergenic
948269852 2:236665937-236665959 CCCCCTTCCCACCACGCCCTCGG + Intergenic
948463951 2:238143307-238143329 CCCCCACCCCACTCTCCCCTTGG - Intronic
948466285 2:238153300-238153322 CACCCCCCCCACCCCGTCTTGGG + Intergenic
948745755 2:240092355-240092377 CCCCCACCCCACCACCCAGCAGG + Intergenic
948854755 2:240724927-240724949 CCCCCCCCCCCCCCCGCCGCCGG - Intronic
948915797 2:241034550-241034572 CCCCCACCCCACCCCCAGGCTGG + Exonic
1169194551 20:3676165-3676187 CACCCACCCCACCCAGCCCAAGG + Intronic
1169588483 20:7114072-7114094 CATCCACCCTCCCCCGCCGTTGG + Intergenic
1169940611 20:10933307-10933329 CCACCCCCCCACCCCGCCCCTGG - Intergenic
1170818315 20:19734146-19734168 CCCCCACCCCATCCCGATTTGGG + Intergenic
1171170493 20:23011367-23011389 CCCCCAACCCACCTCACCATGGG + Intergenic
1171454438 20:25259599-25259621 CCCACACCCCACCCCACCTCCGG + Intronic
1171499124 20:25579567-25579589 CCCCCACGCCACCCTGCCTCTGG + Intronic
1171811376 20:29746105-29746127 CCAACCCCCCTCCCCGCCGTAGG - Intergenic
1172497497 20:35398746-35398768 CCCCCCCCCCCCCCCACCTTTGG - Intronic
1172588599 20:36102103-36102125 CCCACCCCCCACCCCGCCCATGG - Intronic
1172625365 20:36343619-36343641 ACCCCCCCCCAACCCCCCGTTGG + Intronic
1172873924 20:38152834-38152856 CCGCCACTCCAACCCGCCGCCGG + Intronic
1173659773 20:44725046-44725068 CCCCCACCCCACCCCCTAGGTGG - Intronic
1174296337 20:49547951-49547973 CTCCCACACCACCGCGTCGTAGG + Exonic
1174298904 20:49568214-49568236 CGCCCACCCCAGCCCGCTTTGGG + Intergenic
1174361239 20:50030064-50030086 CCCTCACCCCACGCACCCGTAGG + Intergenic
1174498586 20:50967365-50967387 CCCCCACCCCACCCCCCGGGAGG + Intergenic
1174592725 20:51658881-51658903 CCCCCCCCCCCCCCCGCCAGTGG - Intronic
1175220906 20:57415921-57415943 CCCCAACCCCACCCCGCTGCAGG - Intergenic
1175529147 20:59662299-59662321 CCCCCACCCCACCCCAAGCTGGG - Intronic
1175561370 20:59933514-59933536 CTCCCTCCGCGCCCCGCCGTGGG + Intronic
1175606693 20:60317112-60317134 CACCCACCCCACCCCTAAGTTGG + Intergenic
1175732399 20:61362710-61362732 CCCCCACCCCATCCAGCCAGGGG - Intronic
1175802675 20:61810116-61810138 CCCCCACCCCACCCCGGCTGAGG - Intronic
1175839560 20:62018562-62018584 CCCCCACCCCGCCCCACAGATGG + Intronic
1175863169 20:62160953-62160975 CCCCCACCCCACACCCGCCTCGG - Intronic
1175992054 20:62794511-62794533 CCCCGGCCCCGCCCCGCGGTGGG + Intergenic
1176002575 20:62839667-62839689 CACCCACCCCACCTCTCCCTGGG + Intronic
1176002593 20:62839715-62839737 CACCCACCCCACCTCTCCCTGGG + Intronic
1176002611 20:62839763-62839785 CACCCACCCCACCTCTCCCTGGG + Intronic
1177669618 21:24208754-24208776 CCCTCCCCCAACCCCGCCGTGGG - Intergenic
1178332765 21:31713739-31713761 CCCCCACCCCACCCCCGCTCCGG - Intronic
1178440423 21:32593872-32593894 CCCCCACCGCCCCCCGCCGCCGG + Intronic
1179365105 21:40751685-40751707 TCCCCACCCCACCCTACAGTAGG - Intronic
1179955724 21:44737170-44737192 CCTCCACCCCACCCCTCCCCTGG - Intergenic
1180232627 21:46436471-46436493 CCCCCCCCCCCCCCCCCCGCTGG + Intronic
1180342190 22:11628202-11628224 TCCCCACCTCACCCCGTCGAGGG - Intergenic
1180559327 22:16602313-16602335 CCCCGCCCCCATCCCGCCGGGGG - Intergenic
1180938509 22:19641710-19641732 CCCCCACCCAACCCCATCGGTGG + Intergenic
1181057752 22:20268019-20268041 CCCCCTCCGCGCCCCGCCGCCGG + Intronic
1181155769 22:20918967-20918989 CCCCCACCCCTCCCCGCCAAAGG + Intronic
1181322968 22:22022769-22022791 CCCTGACCCCACCACACCGTGGG - Intergenic
1181335378 22:22124760-22124782 CCCCCCACCCGCCCCGCCCTGGG - Intergenic
1181450515 22:23017140-23017162 CCCCCGCTCCCCGCCGCCGTGGG - Intergenic
1181497403 22:23295247-23295269 TGCCCACCCCACCCCACCCTGGG - Intronic
1181527663 22:23499389-23499411 CCCCCACCCCCACCCCCCATCGG + Intergenic
1181565509 22:23734657-23734679 CCACCACCACACCCAGCAGTGGG - Intergenic
1182066276 22:27433841-27433863 CCCCCACCCCACTCATCTGTTGG - Intergenic
1182094105 22:27614607-27614629 CCACCACCCGACCCCGGGGTGGG + Intergenic
1182487750 22:30649481-30649503 ACCCACTCCCACCCCGCCGTGGG - Intronic
1182586501 22:31346703-31346725 CCGCCTCCCCACCCCGCCCGCGG + Intergenic
1183018071 22:35006287-35006309 CCCCCACCCCCACCCACTGTTGG - Intergenic
1183728018 22:39600219-39600241 CCCTCACCCCACCCCCACCTGGG + Intronic
1183748621 22:39706379-39706401 GTCCCTCCCCACCCCGCCTTGGG + Intergenic
1183780262 22:39994899-39994921 GTCCCGCCCCGCCCCGCCGTCGG - Intergenic
1184388798 22:44191268-44191290 CCCCCACCCCACCCCAGCCTCGG + Intronic
1184465760 22:44668410-44668432 CCCTCACCCCACCCCTCGGCGGG - Intergenic
1184525610 22:45020763-45020785 CCCCCACCCCACCTCACCTAGGG - Intergenic
1184674236 22:46031888-46031910 TCCCCACCCCACCCCCCACTTGG - Intergenic
1185006132 22:48277975-48277997 CGCCCACCCCACCCTCCCCTGGG - Intergenic
1185220320 22:49626382-49626404 CCCCAACCCCACCCCACCCTGGG + Intronic
1185238340 22:49727379-49727401 CCCTCACCCGTCCCCTCCGTGGG + Intergenic
1185333372 22:50261378-50261400 CGCTCACCACACCGCGCCGTAGG + Exonic
1185368146 22:50446357-50446379 CCCCCCCCCCCCCCCGCCTCCGG + Exonic
949103982 3:181289-181311 CCCCCACCCCACAAAGCCATTGG - Intergenic
950125215 3:10506277-10506299 CCACCACCACACCCCCCCGAGGG - Intronic
950400943 3:12768880-12768902 GCCCCGCCCCGCCCCGCCATGGG - Intronic
950460823 3:13121374-13121396 GCCTCACCCCTCCCAGCCGTGGG - Intergenic
950531811 3:13556619-13556641 TCCCCACCACACCCTGCCTTGGG - Intronic
951363399 3:21751236-21751258 ACCCCACCCCACCCCACCCTGGG + Exonic
952418860 3:33113915-33113937 GCCCCTCCCCACCCAGCCGGGGG - Intergenic
952495823 3:33914927-33914949 GCCGCACCCCACCCCCCCATGGG + Intergenic
952899427 3:38099768-38099790 CCCCACCCCCACCCCGCCCCCGG - Intronic
952942426 3:38454502-38454524 CCCCCAGCCCACGCCCCCGGAGG - Intronic
953974390 3:47371385-47371407 CCCCACCCCCACCCCGCCGCCGG + Intergenic
954117025 3:48472683-48472705 GTCCCACCCTACCCCGCCCTGGG + Intronic
954377941 3:50204827-50204849 CCCCCACCCCACCCCTGGTTGGG + Intergenic
954384248 3:50236152-50236174 CCCCCGGCCCGCCCCGCCGTCGG + Exonic
954391285 3:50269314-50269336 CCCCCAGCCCCCCACGCCTTCGG + Exonic
954553341 3:51499896-51499918 CCCCCCCCCGACCCCGCCAGTGG + Exonic
954627969 3:52033026-52033048 CCCCCACCGCACCCCACCCCAGG - Intergenic
955533999 3:59904077-59904099 CCCCCACACCCCCCCGCCCCCGG + Intronic
959258236 3:104042046-104042068 CCCCCACCCCACCCCACAACAGG - Intergenic
960104201 3:113776242-113776264 TCCCCACCCCACCCAGTAGTTGG - Intronic
960180569 3:114571498-114571520 TCCTCACCCCACCCCGCTGAAGG - Intronic
960235225 3:115274153-115274175 CCCCCACCCCACCCCGCAACAGG + Intergenic
960685525 3:120289960-120289982 CCCCCGCCCACCCCTGCCGTGGG + Intergenic
961000964 3:123373763-123373785 CCCCCCCCCGACCCCCCCGCAGG + Intronic
961530307 3:127536449-127536471 CCCCCACCCCACCTGGACCTTGG - Intergenic
961677785 3:128578018-128578040 CCCCCACCTCTCCCGGCCCTGGG - Intergenic
961792289 3:129384894-129384916 CCCCCCCCGCCCCCCGCCGAGGG + Intergenic
962235022 3:133700220-133700242 CCCCCACCCCCCACCTCCTTAGG - Intergenic
962383734 3:134916443-134916465 TCCCCACCCCACCCTGCCATGGG - Intronic
962736433 3:138329597-138329619 CCCCCTCCCCACCCCGGAGCCGG + Intronic
966119442 3:176506072-176506094 CCCTCCCCCCGCCCCGCCGCAGG - Intergenic
968092864 3:195909259-195909281 CCCCCACACCACCCCCCGGCTGG + Intronic
968095987 3:195931254-195931276 CCCCCACCCCACCCAACCCCCGG + Intergenic
968096006 3:195931286-195931308 CCCCCACCCCACCCCTGCCCAGG + Intergenic
968578807 4:1380244-1380266 CCCACACCCACCCCCGCCCTCGG - Intronic
968663195 4:1807225-1807247 CCCCGGCCCCACCCAGCAGTGGG + Exonic
968754810 4:2409684-2409706 CAGCCCCCCCACCCCACCGTGGG - Intronic
969112383 4:4852063-4852085 CCCACACCCCACCCCGGGGTGGG + Intergenic
969306563 4:6329222-6329244 CCCGCACCTCACCTCACCGTAGG - Intronic
969846213 4:9922311-9922333 CCCCCACCCCACCCCCCAATGGG - Intronic
969866802 4:10081651-10081673 CCCCCCCCCCACCCCTCCCCGGG - Intronic
970408612 4:15786816-15786838 CCCCCCACCCTCCCTGCCGTGGG - Intronic
970487911 4:16542922-16542944 CCCTCCCCCCACCCCACCATAGG + Intronic
972323108 4:37991051-37991073 CCCCCACCCACCCCCGCCCCAGG - Intronic
973341296 4:49007623-49007645 CCCTCACCCCACCCCACAGCAGG + Intronic
973687990 4:53393767-53393789 CCCCCCCCCCCCCCCGCCCCCGG + Intronic
974296879 4:60011738-60011760 CCCCCCCCCCACCCCACAATAGG - Intergenic
975280862 4:72560678-72560700 CCTCCACCCCACCCCTCAATGGG - Intronic
975385272 4:73750804-73750826 CCCCCACCCCACCCCCTCCCTGG - Intergenic
975870660 4:78776042-78776064 CCCCCCCCCCCCCCCGCCAACGG + Intergenic
976107341 4:81633212-81633234 TCCCCACCACACCCCACCCTGGG + Intronic
976690564 4:87863747-87863769 CTCCCGCCCCCCACCGCCGTGGG - Intergenic
977536668 4:98261757-98261779 ACCCCACCCCAGCCCGCGCTCGG - Intronic
978526279 4:109670272-109670294 CCCCCACCCCCCACCACCTTAGG + Intronic
978917949 4:114148670-114148692 CCTCCCCCACACCCTGCCGTGGG - Intergenic
979318131 4:119291143-119291165 TCCCCACCCCACCCAACCCTAGG + Exonic
982756092 4:159220357-159220379 ACCCCATCCCACCCCACTGTGGG - Intronic
982780216 4:159482658-159482680 CCCTCACCCCACCCCCTTGTGGG - Intergenic
983019420 4:162656455-162656477 CCCCCACCCCACCCCCCGACAGG - Intergenic
983535009 4:168848159-168848181 ACCCCACCCCACCCCACCCCTGG + Intronic
984022909 4:174507535-174507557 CCCACACCCCACCCCAACCTTGG - Intronic
985273902 4:188219378-188219400 CCACCTCCCCACCCCGCCCACGG + Intergenic
985589626 5:757815-757837 CTCCCACCACACCCCGGCCTGGG - Intronic
985638360 5:1051383-1051405 TCCCCACCCCACCCCACCCCAGG - Exonic
985722013 5:1494402-1494424 CCCCCCCCCCACCACGCTGCTGG - Intronic
985767216 5:1786311-1786333 CCCCCACCCAACTCCCCCTTGGG - Intergenic
986620365 5:9666632-9666654 CCCCCACCCCACCCAGCAATAGG - Intronic
987132426 5:14871882-14871904 CCCCCTCCCCAGCCCGCCCCCGG - Intergenic
987352254 5:17032515-17032537 CCGCCGGCCCACCCCTCCGTGGG - Intergenic
987949271 5:24654875-24654897 CCCCCACCCCACCCCACCACAGG + Intergenic
988064546 5:26218117-26218139 ACCCCACCCCACCCCTGCCTAGG + Intergenic
989408054 5:41083691-41083713 CCCCCACCCCACCCCGCGCTTGG - Intergenic
990075581 5:51842927-51842949 CCCCCCCCCCCCCCCCCCGCAGG + Intergenic
990213513 5:53506076-53506098 CCACCACCGCACCCAGCAGTTGG + Intergenic
990351199 5:54918563-54918585 CCCTCCCCCCACCCCCCCGCAGG - Intergenic
990449945 5:55924644-55924666 CCCCCACCCCCACGCGCCCTTGG + Intergenic
992026459 5:72674468-72674490 CCCCCACCCAACCCCGCAACTGG + Intergenic
993026596 5:82654016-82654038 CCCCCACCTCCCCCCACCGCTGG - Intergenic
993619641 5:90152716-90152738 CCCTCCCCCCACCCCACGGTAGG - Intergenic
993944170 5:94097844-94097866 CCACCACCCCACCCCACCGCTGG + Intronic
994252712 5:97555775-97555797 CCCCCGCCCCACCCTGCCACAGG + Intergenic
995700431 5:114929180-114929202 CCCCCATCCCCCCCGGCTGTGGG + Intergenic
996356909 5:122605498-122605520 CCCCATCCCCACCCAGCCCTTGG + Intergenic
997391981 5:133524673-133524695 CCCCCACCCCGCCCCTGGGTGGG + Intronic
997464792 5:134079973-134079995 CCCCCACCGCAGGCCGCCTTTGG - Intergenic
997479979 5:134177446-134177468 CCCCCACCCCACCCCACCCCAGG - Intronic
997549387 5:134738643-134738665 CCCCGGCCTCTCCCCGCCGTCGG - Exonic
998371492 5:141664873-141664895 CCCCCACCCCCCACCCCCATTGG + Intronic
998383468 5:141742327-141742349 CCCCCACCCCACCCAGCCTCAGG - Intergenic
998957418 5:147452680-147452702 TCCCCTCTCCACCCCGCCCTAGG + Intronic
999782137 5:154858186-154858208 CCCCCCCACCCCCCCGCCGTGGG - Intronic
1000728097 5:164797636-164797658 CCGCCCCCCCGCCCCGCCTTTGG + Intergenic
1001401923 5:171451049-171451071 CCGCCCCCCCACCCCGCCGCCGG + Intronic
1001588589 5:172850301-172850323 GCCCCACCCCACCCCACCCTGGG + Intronic
1001661547 5:173396953-173396975 CCCCCTCCCCTGCCTGCCGTGGG - Intergenic
1002028060 5:176408900-176408922 TCCCCATCCCACCCCACCCTTGG + Intronic
1002042869 5:176527578-176527600 CTCCCGCCCCAGCCTGCCGTGGG - Exonic
1002381427 5:178832281-178832303 CCCCCCCCTCACCCCACCTTGGG + Intergenic
1002599546 5:180346465-180346487 CCCCCACCCCACCAGGGCCTCGG + Intronic
1002603642 5:180369571-180369593 ACCCCACCCCACCCCACGATGGG - Intergenic
1002639362 5:180623438-180623460 CCCCCACCCCACCCCCAGCTGGG + Intronic
1002643256 5:180640532-180640554 CCTCCACCACACCCCTCCTTGGG + Intronic
1002670478 5:180861835-180861857 CCCCCTGCCCACCCCACCGCCGG + Intergenic
1002771358 6:292741-292763 CCCCCACCCCACCCGGCTTCCGG + Intronic
1002925819 6:1605154-1605176 AGCCCACCTCACCCCGCCGGCGG + Intergenic
1003107795 6:3228689-3228711 CCACCCCCCCACCCCGCCCTCGG + Intronic
1003290601 6:4776070-4776092 CCCCCAGCCCGCCTCGACGTGGG - Intronic
1003506654 6:6745803-6745825 GCCTCCCCCCACACCGCCGTGGG - Intergenic
1003591642 6:7441484-7441506 CCCCGTCCCAACCCCGCCCTGGG + Intergenic
1003749599 6:9040964-9040986 CCACCACCCCCCACCGCCGTGGG + Intergenic
1003985028 6:11426788-11426810 CCCCCACCCCACGCCTCCCCAGG - Intergenic
1004144603 6:13053419-13053441 CCCACACCCCACCCATCCGCAGG + Exonic
1004250341 6:14018270-14018292 CTCCCCCCACCCCCCGCCGTGGG + Intergenic
1004255249 6:14057759-14057781 ACCCCACCCCACCCCACCCCAGG - Intergenic
1004699425 6:18065319-18065341 CCCCTCCCCCACCCAGCCCTTGG + Intergenic
1005438275 6:25837862-25837884 CCCCCACCCCACCCAACCTCTGG - Intronic
1005484534 6:26286931-26286953 CTCCCACCCCACCCCACCCTTGG - Intergenic
1005826323 6:29633261-29633283 CGCCCGCCCCACCGCGCTGTGGG - Intronic
1006075793 6:31531405-31531427 CCCCCACCCCACCCCACAACAGG - Exonic
1006430647 6:33993595-33993617 CCCCACCCCCGCCCCGCCATGGG + Intergenic
1006512425 6:34528895-34528917 GGCCCACCCCACCCCGCCCGTGG - Intronic
1006881677 6:37345396-37345418 CCCCCACACCACCCCACGGCAGG + Intergenic
1007521230 6:42452864-42452886 CCCCCACCGCACCCTGGCCTCGG + Intergenic
1007521455 6:42453703-42453725 CCCCCACCCCACCCCCACCCGGG + Intergenic
1008382417 6:50849964-50849986 CCCACACCCCACCCCGTCGTGGG - Intergenic
1008660721 6:53664906-53664928 CCTACACCCCACCCCGAGGTTGG - Intronic
1008899561 6:56595780-56595802 CCCCCACCCCACCCCGAGAAGGG + Intronic
1009872304 6:69467484-69467506 CTCCGCCCCCACCCTGCCGTGGG + Intergenic
1011983542 6:93416879-93416901 CCCCCGCCCCGCCCCTCCGACGG - Intronic
1012245776 6:96924461-96924483 CCCGCCCCCGCCCCCGCCGTCGG - Intergenic
1013330581 6:109095730-109095752 CACCCACCACACCCCGCGCTTGG - Intronic
1013369268 6:109455666-109455688 ACCTCACCCCACCCGGCCGCGGG + Intronic
1013498195 6:110719981-110720003 CCCCCACCCCCCCCCTGCTTCGG + Intronic
1016949575 6:149566620-149566642 CCCCCGCCCCTGCCCGCCGGTGG - Intronic
1017447356 6:154518790-154518812 CCCCCACCCCACCCCCCCACAGG + Intergenic
1017478171 6:154821054-154821076 TCCTCACCCCACCCCGCCAATGG + Intronic
1017616454 6:156251739-156251761 TCCCCACCCCACCCCACCCCCGG + Intergenic
1019287365 7:230360-230382 CCCCCCCCCCACCCCGTCCTGGG - Intronic
1019347933 7:539685-539707 ACCCCACCCCACCCCACCCCCGG - Intergenic
1019425616 7:975276-975298 CCTCCGCCCCACCCAGCCCTGGG - Intronic
1019447346 7:1078337-1078359 GCCCCCCCCCACCCCGCAGCTGG - Intronic
1019515704 7:1438967-1438989 CCCCCTCCCCACCCCGCCGCAGG - Exonic
1019555194 7:1625741-1625763 CCCACACCTAATCCCGCCGTGGG - Intergenic
1019606620 7:1913357-1913379 CCCCCACCCCACGCCACCCCAGG - Intronic
1019663969 7:2242150-2242172 CGCCCAGCTCACCCCGCCATTGG + Exonic
1019705082 7:2493790-2493812 CCCCACCCCCACCCTGCCTTGGG + Intergenic
1019940067 7:4282734-4282756 CCCCCACACCACCCTGCAGCAGG - Intergenic
1020130168 7:5555210-5555232 CCCCCACCCCGCCCCTCGGCCGG + Intronic
1021868681 7:24981880-24981902 CCCACGCCCAGCCCCGCCGTCGG + Intergenic
1022163952 7:27740032-27740054 CCCCCAGCCCACTCCGCCGCGGG - Intronic
1022395933 7:29988667-29988689 CACCCACCCCACCCGGCTGCCGG + Intronic
1022508996 7:30923359-30923381 CCCACAGCCCACCACCCCGTTGG - Intronic
1022973486 7:35537300-35537322 CCCCCGCCCCGCCCTGCCGCGGG - Intergenic
1023524964 7:41092660-41092682 TTCCCTCCCCACCCCGCAGTTGG + Intergenic
1024084619 7:45883111-45883133 CCCCCACCCCTCCCTGCTCTTGG + Intergenic
1024381537 7:48702603-48702625 CCCCCACCCCCACCCACTGTGGG - Intergenic
1024567895 7:50697820-50697842 CCCCCACCCCACCCCAGGGAGGG + Intronic
1026947946 7:74328129-74328151 CCCCCAGCCCACCCCGACCAGGG - Intronic
1027215399 7:76180216-76180238 CCCCAACCCCACCCCACCCATGG + Intergenic
1027438481 7:78192886-78192908 TCCCCACCTCACCCCACCGTGGG - Intronic
1028020554 7:85765864-85765886 CCCTGACCCCTCCCCGCAGTAGG - Intergenic
1028410501 7:90525530-90525552 CCCCCACCCCACCCCACAACAGG + Intronic
1028986394 7:97012616-97012638 CCCCCACCCCAGACTGCCCTTGG + Intergenic
1029109437 7:98204974-98204996 CATTCACCCCACCCCGCCCTCGG - Intronic
1029386559 7:100247382-100247404 CCACCACCCAACCCCGGCCTTGG + Intronic
1031091152 7:117356462-117356484 CCCCAATCCCACCCAGCCCTAGG - Intergenic
1031253100 7:119413432-119413454 CCCCGGGCCCACCCCGCTGTGGG - Intergenic
1031513265 7:122673900-122673922 CCACCCCCACCCCCCGCCGTGGG - Intronic
1032081048 7:128858675-128858697 TCCCCACCCCACCGCGCCCCAGG + Exonic
1032134335 7:129261616-129261638 CCCCTTCCCTACCCCACCGTAGG + Intronic
1032178062 7:129649307-129649329 CCCCCACCCCACCCCGGGTTTGG + Intronic
1033220711 7:139524761-139524783 CCCACACCACACGCCGCCGGCGG - Intronic
1033779357 7:144650699-144650721 CCCCCACCGCCACCCGCCATGGG + Intronic
1034137799 7:148787613-148787635 CCCCTTCCCCACCCCACTGTGGG + Intronic
1034162902 7:149005854-149005876 CCCCCACCCCCCACCCCCGCAGG + Intronic
1034466112 7:151230161-151230183 CCCCCTGCCCACCCTGCCCTGGG + Intergenic
1034617916 7:152435506-152435528 CCCCGCCCCCACCCCGCCGGGGG + Intronic
1034620286 7:152451663-152451685 CCCCCCCCGCCCCCCGCCGCAGG + Intergenic
1034967065 7:155398231-155398253 CCCCCGCCCCCCGCCTCCGTGGG - Intergenic
1035748195 8:1976564-1976586 CCCACCCCCCACCCTGCTGTGGG + Intronic
1035832383 8:2710839-2710861 CCCCCGCCCCACACTGCCCTAGG + Intergenic
1036210294 8:6835374-6835396 CCCTAACCCCACCCCGGCGCCGG - Intronic
1037371491 8:18184031-18184053 CCCCCCCACCACCCCGCCCCGGG - Intronic
1038345261 8:26726457-26726479 CCTCCACCACTCCCCGCTGTGGG - Intergenic
1039258989 8:35750281-35750303 CCCCAACCCCACCCCACCCCAGG + Intronic
1040107175 8:43547653-43547675 CCCACAACCCACCCTGGCGTCGG + Intergenic
1040628641 8:49181926-49181948 CCCTCACCCCACCCCACAGCAGG + Intergenic
1041066298 8:54085795-54085817 CCCCCCCCCCACCTCGCGGACGG - Intronic
1041690284 8:60680100-60680122 CCCGCCCCCCAACCCGCCGGGGG + Intronic
1042271813 8:66962611-66962633 CCCCGAGCCCGCCCCGCCGGAGG - Intergenic
1042578911 8:70254682-70254704 CCCCCACCCCCGCCCGCCCCTGG - Intronic
1044343151 8:91070677-91070699 CCCCTACCCCGCGCCGCCGCCGG + Intronic
1044751934 8:95424392-95424414 TCCCCACCCCACCACCCCCTTGG - Intergenic
1046907235 8:119586944-119586966 CTCCCACCCCTCCCCGCCGGGGG + Intronic
1047072005 8:121355707-121355729 CCACCATCCCACCCCGCCTCTGG + Intergenic
1047654485 8:126961843-126961865 CCCCCACCCCACCCCCCGCCCGG - Intergenic
1047761653 8:127959031-127959053 ACCCCACCCCACCCCGCTAAGGG - Intergenic
1048018229 8:130516309-130516331 CCTCCATCCCAGCCCGCAGTAGG - Intergenic
1048110218 8:131460068-131460090 CCCCCACCCCACCCCACAACAGG - Intergenic
1048859503 8:138713709-138713731 CACCCCCACCGCCCCGCCGTAGG + Intronic
1049037179 8:140085918-140085940 CCCCCACCCCACACCCCCTTAGG + Intronic
1049106457 8:140616782-140616804 CCCCCACCTCACTCGGCCTTGGG + Intronic
1049195461 8:141313268-141313290 CCCCCACCCCACCGCTGTGTAGG - Intergenic
1049239332 8:141528970-141528992 GCCCCACCCCACCTAGCCCTGGG + Intergenic
1049293964 8:141819944-141819966 CTCCCACCCCTCCCTGCCTTGGG - Intergenic
1049435980 8:142586473-142586495 CCCCCACCACAGCCAGGCGTGGG + Intergenic
1049493177 8:142915670-142915692 TCCCCACCCTTCCCCGCCCTGGG + Intronic
1049537718 8:143189773-143189795 CCCCCACCCCCCACCCCCGTGGG + Intergenic
1049657057 8:143803616-143803638 CCCCCACCCCAGCCCGCCCTGGG - Intronic
1049684596 8:143934231-143934253 CCCCCTCCCCGCCCCGCCCCCGG - Intronic
1049745663 8:144262208-144262230 CTTCCACCCCACCCAGCCGTGGG - Exonic
1049798641 8:144507702-144507724 CTCCCACTCCACCCAGCCGAAGG - Intergenic
1051143992 9:14007440-14007462 CCCCCCCCCCCCCCCCCCGTTGG - Intergenic
1053393468 9:37752197-37752219 CCCACCCCCACCCCCGCCGTGGG + Intronic
1054820870 9:69519193-69519215 TCCCCACCCCACCCTGCTGCTGG - Intronic
1055596196 9:77867167-77867189 CCCCCACTTCCCCCCGCCTTGGG + Intronic
1056815119 9:89795585-89795607 TCCCCTCCCCACACCGCCCTGGG + Intergenic
1056963296 9:91145474-91145496 CCCCAACCCCACCCCAGCTTGGG - Intergenic
1057379295 9:94554155-94554177 CCCCACCCTCACCCCGCCATGGG + Intergenic
1057386310 9:94608604-94608626 CCCCCACCCCACCCCTACCCAGG + Intronic
1057694339 9:97312679-97312701 CCCCCACCCCAACCCACCCCCGG + Intronic
1057829301 9:98394739-98394761 CCCCCACCCCAGCCCCTCCTTGG + Intronic
1058857369 9:109076373-109076395 CCTCCCCCCCACCCCACAGTGGG - Intronic
1059414566 9:114155222-114155244 CCCCTACCCCAACCCCCCATTGG + Intergenic
1059466296 9:114470812-114470834 CCCCCGCCCCACCCCACCCCGGG + Intronic
1059503277 9:114775152-114775174 CCCCCACCCCTCCCCTTGGTGGG + Intergenic
1059526981 9:115001101-115001123 CCCCCACCCCACCCCCCGACAGG + Intergenic
1059791129 9:117642852-117642874 CCTCCCCCCCGCCCCTCCGTGGG - Intergenic
1060514571 9:124257903-124257925 CGCCCGCCCCTCCCCGCCGCGGG - Intronic
1060744794 9:126124206-126124228 CCCCCCCCCCCCCCCGCCCCAGG + Intergenic
1060945910 9:127569196-127569218 GCCCCGCCCCGCCCCGCCCTCGG + Intronic
1060989979 9:127843063-127843085 CCCCCACCCGACCCTGCCATGGG + Intronic
1061113628 9:128593739-128593761 CCCCCACCTCACCCCAGCCTGGG + Intronic
1061166030 9:128922549-128922571 TCCCCACCCCACCCTACCCTGGG - Intronic
1061250426 9:129423103-129423125 CCCCCGCCCCACCCCCTCCTCGG - Intergenic
1061881692 9:133572179-133572201 CCCACCCCCCACCCCGCCCCAGG + Intronic
1061912417 9:133732244-133732266 CCCCCACCCCAGCCCCCCGCAGG + Intronic
1062107833 9:134765485-134765507 CCTCCACCCCACCCTGGTGTTGG - Intronic
1062165084 9:135103609-135103631 CCCCAGGCCCACCCTGCCGTGGG - Intronic
1062216082 9:135390571-135390593 CCCCCACCTCATCCCTCCGTGGG - Intergenic
1062287842 9:135781043-135781065 CCCACGCTCCGCCCCGCCGTGGG + Intronic
1062612271 9:137380499-137380521 CCCCCACCCCAACCCCCCTCTGG + Intronic
1062688522 9:137828571-137828593 CCCCCACCCCGCACCCCCGCAGG - Intronic
1185621500 X:1453439-1453461 GCCCCTCCCCACCCCGCCTGCGG + Intronic
1186192811 X:7082751-7082773 CCGTCACCCCACCCCACCATGGG + Intronic
1186344312 X:8675856-8675878 CCCCCACCCCACCCCCCGACAGG + Intronic
1187372973 X:18725753-18725775 GCCCCACCCCACCCCAGCTTGGG - Intronic
1187826060 X:23334426-23334448 TCCCCGCGCCACCCCGTCGTTGG + Exonic
1188005731 X:25014507-25014529 CCCCCACCCTCTCCCGCTGTGGG - Intronic
1188225979 X:27598349-27598371 CCCCCACCCAACCCCCCCGAGGG + Intronic
1188662758 X:32779696-32779718 ACCCCACCCCACCCCACCACAGG - Intronic
1189234284 X:39475705-39475727 CCCCCACCCCACCCCCACCGAGG - Intergenic
1190117851 X:47637721-47637743 CACACACCCCACCCCTCCGCAGG + Intronic
1191689554 X:63925996-63926018 CCCCCTGCCCACCCCTCCCTTGG + Intergenic
1191964315 X:66740522-66740544 CCCTCCCCCCACCCCGCAATAGG + Intergenic
1192251442 X:69417042-69417064 CCTCTCCCCCCCCCCGCCGTGGG + Intergenic
1192361982 X:70445915-70445937 CCCCCTCCCCTCCCCTCCGGTGG - Intronic
1193257469 X:79367074-79367096 CCCCTCCCCCATCCCGCCCTGGG + Intronic
1195033743 X:100951437-100951459 CCCCCACCCCCCACCCCCGGGGG - Intergenic
1195177742 X:102327057-102327079 CCCCCGCCACCCCCCGCCGCAGG - Intergenic
1195181122 X:102360036-102360058 CCCCCGCCACCCCCCGCCGCAGG + Intergenic
1195649491 X:107270354-107270376 CCCCCACCCCACCCCACCACAGG + Intergenic
1196031566 X:111098916-111098938 CCCCCACCCCCACCTGCCGGGGG + Intronic
1199265341 X:145821195-145821217 CCCCCACCCCTGCCCTCCATAGG + Exonic
1199285068 X:146046273-146046295 CCGCCACCCCACCCTACCTTGGG - Intergenic
1199455340 X:148021443-148021465 CCCCCATCCTACCCCGCCATAGG - Intronic
1200000364 X:153056788-153056810 CCCCCACCCCCACCCCCCGTGGG - Intronic
1200309449 X:155062755-155062777 CCCCCCGCCAACCCCGCCCTTGG - Intronic
1200698535 Y:6382589-6382611 CCCTCTCCCCGCCCCGCCCTGGG + Intergenic
1200787605 Y:7273903-7273925 CCCCGCCCCCACCCGGCCGCGGG - Intergenic
1201035579 Y:9782110-9782132 CCCTCTCCCCGCCCCGCCCTGGG - Intergenic
1201730327 Y:17195245-17195267 CCCCCACCCTTCCCAGCCTTTGG + Intergenic