ID: 1168232054

View in Genome Browser
Species Human (GRCh38)
Location 19:55038885-55038907
Sequence CCGGCTATAATTTTTTTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168232050_1168232054 -10 Left 1168232050 19:55038872-55038894 CCACTGCACCCGACCGGCTATAA No data
Right 1168232054 19:55038885-55038907 CCGGCTATAATTTTTTTTAATGG No data
1168232047_1168232054 18 Left 1168232047 19:55038844-55038866 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1168232054 19:55038885-55038907 CCGGCTATAATTTTTTTTAATGG No data
1168232048_1168232054 17 Left 1168232048 19:55038845-55038867 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1168232054 19:55038885-55038907 CCGGCTATAATTTTTTTTAATGG No data
1168232044_1168232054 27 Left 1168232044 19:55038835-55038857 CCTCGGTCTCCCAAAGTGCTGGG 0: 2640
1: 124515
2: 269098
3: 211395
4: 128259
Right 1168232054 19:55038885-55038907 CCGGCTATAATTTTTTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168232054 Original CRISPR CCGGCTATAATTTTTTTTAA TGG Intergenic
No off target data available for this crispr