ID: 1168232842

View in Genome Browser
Species Human (GRCh38)
Location 19:55044376-55044398
Sequence TACCATGAGAATTGATAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168232842 Original CRISPR TACCATGAGAATTGATAGGA AGG Exonic
906654991 1:47541639-47541661 TACCATGAGAATAGAATGGGGGG - Intergenic
911099913 1:94087464-94087486 CACCAGGAGAAGTCATAGGATGG + Intronic
912006687 1:104911768-104911790 TACTATGAAAATTGAAAGGGGGG - Intergenic
912869029 1:113286362-113286384 CAACATGAGAATTGATAATAGGG + Intergenic
916543232 1:165777543-165777565 TACCAAAAGAATTGAAAGCAGGG + Intronic
918566132 1:185934869-185934891 TACCATGAGAATTAACAAAATGG + Intronic
918691632 1:187487847-187487869 TACCATGAGAATAGTTAAGTGGG + Intergenic
920026069 1:202997993-202998015 TACCAAAAGAATTGAAAGCAGGG + Intergenic
922090759 1:222393075-222393097 TACAATGAGAAATGAAAAGAAGG + Intergenic
923487080 1:234443614-234443636 TTCCAAGAGAATTGAAAGCAGGG + Intronic
923809664 1:237299235-237299257 TACCATGAGAATAAAGAAGAGGG - Intronic
923809852 1:237301753-237301775 TACCATGCGAATAAAGAGGAGGG - Intronic
924559221 1:245143663-245143685 AACCTTTAGAATTGAGAGGATGG + Intergenic
924719591 1:246609607-246609629 TGCCATGAAAATGGAAAGGAGGG - Intronic
1062896541 10:1107341-1107363 TCTCATGAGAATTCATTGGAAGG + Intronic
1064471747 10:15642376-15642398 TACCAGGAAAATTGACAGAAAGG - Intronic
1067804440 10:49383237-49383259 TACCGTGAGAATTGAATGGCAGG + Intronic
1068867147 10:61906282-61906304 TACCATGAAAATGAATAGCAGGG + Intronic
1070967023 10:80536075-80536097 GCCCAGGAGAATTGATAGGCGGG + Intergenic
1071918518 10:90323866-90323888 TACCATGAGAAGTAATAGGAAGG - Intergenic
1073534918 10:104268228-104268250 CAACATGGGATTTGATAGGAAGG - Intergenic
1073857244 10:107691526-107691548 TAAAATAAGAATTGATAGGCTGG - Intergenic
1073933877 10:108607008-108607030 TTCCATGCTTATTGATAGGAAGG - Intergenic
1076508689 10:130997233-130997255 TACCACAACAATTGATAGGATGG - Intergenic
1079677392 11:23247253-23247275 TGCCATGAGAATGGATACAAGGG + Intergenic
1080306376 11:30840723-30840745 TCCCATGAGGATTGCAAGGAAGG + Intronic
1080589021 11:33705289-33705311 TACACTGAGAATTTATTGGAGGG + Intronic
1081378979 11:42391929-42391951 TACATTGAGAATTTATAGGAAGG - Intergenic
1081947004 11:47005487-47005509 TACACTGAGAATTGAGAGTAAGG + Intronic
1085656540 11:78320394-78320416 CACCATGAGAATTAATAGCAAGG + Intronic
1086003366 11:82006325-82006347 GATCATAAGAATTGAAAGGAGGG + Intergenic
1086186694 11:84026098-84026120 TAGCAAGAGAAGTTATAGGACGG + Intronic
1086642262 11:89174291-89174313 TACCATTATAATTGAAAGGAGGG + Intergenic
1090564161 11:127968461-127968483 TACTCTGAGAAATGAAAGGAAGG - Intergenic
1091984944 12:4902534-4902556 TACCATGATCATGGATTGGAAGG - Intergenic
1092774582 12:11931285-11931307 TACAATGAAAAATGATATGAAGG - Intergenic
1093144284 12:15545714-15545736 TAAGAAAAGAATTGATAGGAGGG - Intronic
1096346148 12:50848627-50848649 CACCATGAAAATTGATGAGAAGG - Intronic
1096974554 12:55692715-55692737 TCCCATCACAATTCATAGGAGGG - Intronic
1097746353 12:63307977-63307999 TAACACGAGAAATGACAGGAGGG - Intergenic
1106581489 13:31022311-31022333 TATCTTGAGAATTGAGAGGAAGG + Intergenic
1107114152 13:36728331-36728353 TGCCATGTGAAATGAAAGGACGG + Intergenic
1110300343 13:73919248-73919270 TACCATGAAAATTCCTAGAATGG + Intronic
1112172418 13:96988039-96988061 TACCATGAGAGTTAAAATGAGGG + Intronic
1112202502 13:97290747-97290769 TACTATGAGAATTACTAGAAAGG + Intronic
1112647446 13:101350459-101350481 TACCTTGAGAAGTTATAGCAGGG - Intronic
1115160117 14:30384352-30384374 CACCTTGAGAGTTGACAGGAAGG + Intergenic
1115300320 14:31878242-31878264 TAAAATGAGTATTGAAAGGATGG + Intergenic
1116106280 14:40512102-40512124 TACCATGAGCATAGATAACAGGG + Intergenic
1116896331 14:50318788-50318810 TACCATGAGAATCTAGAGAAGGG - Intronic
1117996837 14:61485717-61485739 TATCATGAGAAGTGGAAGGATGG - Intronic
1119554763 14:75544680-75544702 TATCATGAGAATTAATTTGAAGG - Intronic
1119602962 14:75989648-75989670 TACTATGGGAAGTGAAAGGAAGG - Intronic
1119914391 14:78383754-78383776 TACCTTGAGAGCAGATAGGATGG + Intronic
1124065914 15:26343556-26343578 TACCATGAAATTTATTAGGAAGG + Intergenic
1132394437 15:101462308-101462330 TACCATGCTCATGGATAGGAAGG + Intronic
1133612448 16:7446233-7446255 ACCCATGCGAATTGACAGGAAGG + Intronic
1145410255 17:22654415-22654437 TACCAGGAAAATTGAGAAGAGGG + Intergenic
1150547436 17:66174410-66174432 TACCAAGAGAATGGTGAGGAAGG + Intronic
1153346502 18:4031747-4031769 TACCATAGGAAATGATTGGAAGG + Intronic
1153466900 18:5398051-5398073 AACCAACAGAATTCATAGGAGGG - Exonic
1154470814 18:14699252-14699274 TGCCATCAGAATTGAAAGAAGGG - Intergenic
1156182081 18:34616742-34616764 TTCCATGCTCATTGATAGGAAGG - Intronic
1159944446 18:74433558-74433580 TGAGATGAGAATTGAGAGGAGGG + Intergenic
1159970181 18:74641237-74641259 TACCATAACAATGGAAAGGAGGG - Intronic
1163482461 19:17565705-17565727 AACCAAGAGAATTGAAAGAAAGG - Intronic
1165173326 19:33908399-33908421 TACAATAAAAATTGGTAGGAAGG - Intergenic
1165751574 19:38263812-38263834 CAGCATCAGAATTGAGAGGAAGG - Intronic
1168010733 19:53529884-53529906 TACCTTGAGAGGTGCTAGGAAGG + Intronic
1168232842 19:55044376-55044398 TACCATGAGAATTGATAGGAAGG + Exonic
1168608144 19:57776269-57776291 TACCAGGGGAATTGCTAGAAAGG + Intronic
1168609786 19:57790000-57790022 TACCAGGGGAATTGCTAGAAAGG + Intronic
925106956 2:1299855-1299877 TACCATGAGAATTCAACGTAAGG + Intronic
925826504 2:7853250-7853272 TTCCATGAAAATTGATAGAGAGG - Intergenic
926451354 2:13007926-13007948 AACCATGTGAATTTATTGGAAGG + Intergenic
926552343 2:14315772-14315794 CACCATGAGCATTAATAGGAAGG - Intergenic
927004000 2:18828472-18828494 CACCCTGAGGCTTGATAGGAAGG - Intergenic
928321323 2:30284710-30284732 TACAATGAGGAGTCATAGGAAGG - Intronic
928607137 2:32953418-32953440 TACCATGACAACTGCTAGGAGGG + Intronic
929692289 2:44084984-44085006 GACCCTGAGAATAGAAAGGAAGG - Intergenic
930536886 2:52654548-52654570 TTGCATGGGAATGGATAGGAAGG - Intergenic
931324695 2:61207930-61207952 TACCATAAGAATTCACAGGTAGG - Intronic
931469997 2:62529922-62529944 TACCATAAACACTGATAGGAGGG + Intergenic
931795930 2:65710104-65710126 TACAATGGGAATTCATTGGACGG + Intergenic
932928855 2:76009895-76009917 TACCATGAGAGATAATGGGAAGG + Intergenic
937770113 2:125710795-125710817 GTCCAGGAGAATTGATTGGATGG - Intergenic
937968138 2:127530149-127530171 TACCATGGGAATTAAAAGGAGGG + Intergenic
939300954 2:140337753-140337775 TACCATGAGGATTGAAAATAAGG - Intronic
939910798 2:147980372-147980394 TACCATGCCAATTTATAGAAAGG + Intronic
939912792 2:148004133-148004155 TTCCATGCGCATGGATAGGAAGG + Intronic
941081588 2:161067296-161067318 TACCATGGGAGCTGAAAGGATGG - Intergenic
944348258 2:198695135-198695157 TATCAGGAGAAATGCTAGGAAGG + Intergenic
947479387 2:230484306-230484328 TGCCACGAGTATTGATTGGAGGG + Intronic
1173441376 20:43079516-43079538 TACCATGTTTATGGATAGGAAGG - Intronic
1175572393 20:60033952-60033974 TTCTATGAGAATTTATAGAAGGG - Intronic
1176803670 21:13458685-13458707 TGCCATCAGAATTGAAAGAAGGG + Intergenic
1177043207 21:16138285-16138307 TACTATGCCACTTGATAGGAGGG - Intergenic
1177216563 21:18137242-18137264 TCCCAGGAGCAATGATAGGAAGG - Intronic
1179056865 21:37944430-37944452 CACCATCAGAATTGCTTGGAGGG + Intergenic
1182990761 22:34765299-34765321 CACCATGAGAACTCAGAGGAGGG + Intergenic
950382025 3:12624152-12624174 TGCCATGAAAATGGTTAGGAAGG - Intronic
950508020 3:13407733-13407755 TGCCATGGGAGCTGATAGGAGGG - Intronic
951158239 3:19381674-19381696 TACCACGAGAATTGCTAAAAGGG + Intronic
952684237 3:36131041-36131063 TAAAATGAGAATTTCTAGGATGG - Intergenic
952875340 3:37940186-37940208 TACAATGAGTCTTGTTAGGATGG - Intronic
955736639 3:62045756-62045778 TACCATCAGAATTAGTGGGAAGG - Intronic
958993498 3:100874487-100874509 TGCAATGAGAATTGATGTGAAGG - Intronic
962637528 3:137346373-137346395 TATCATGAGAGTTCAGAGGAGGG - Intergenic
966171635 3:177088083-177088105 TACACTGAGAATTTATAGAAAGG + Intronic
972035491 4:34514483-34514505 TACCATGGGAACTTAGAGGAAGG - Intergenic
972095223 4:35340400-35340422 TGGCATGAGAATGGATATGAAGG + Intergenic
974991510 4:69096461-69096483 AACCATGAGAAATGACAGAAAGG + Exonic
975021470 4:69495899-69495921 CACCATGAGAAATGACAGAAAGG - Exonic
975844502 4:78510844-78510866 GACCATGAGAATTCCTGGGAAGG + Intronic
977874433 4:102131809-102131831 TTAGATGAGAAATGATAGGATGG - Intergenic
977998295 4:103523389-103523411 TACCAAAAGAATTGAAAGCAGGG - Intergenic
978400612 4:108326470-108326492 TCCCATGAGTATGGAAAGGAGGG - Intergenic
979081632 4:116351088-116351110 AACCATGAGAATGGATATAAAGG - Intergenic
982731978 4:158965614-158965636 GAACATGAGATTTGATATGAAGG + Intronic
983891398 4:173033854-173033876 TTACATGGAAATTGATAGGAGGG + Intronic
985365223 4:189223918-189223940 TAGCTAGAGAATTGATAGGAGGG - Intergenic
989478653 5:41903385-41903407 TTCCATGAGAAACAATAGGATGG + Intergenic
990846793 5:60149736-60149758 TGCTATGAGAATGCATAGGAAGG - Intronic
991001762 5:61790077-61790099 TCCCCTGAGATTTGTTAGGATGG - Intergenic
991517354 5:67452312-67452334 TACCATGGGAAGTGAGAGGAAGG - Intergenic
994560079 5:101357853-101357875 TACCATGAGGATAGAGAAGATGG - Intergenic
1001593030 5:172879398-172879420 TTCCATGAGAATGTACAGGAAGG - Intronic
1002346495 5:178551635-178551657 GGCCATGAGAATTGATAGCCGGG - Intronic
1005388542 6:25310260-25310282 TACCATGAGAACATAAAGGAGGG + Intronic
1005993272 6:30916562-30916584 TTCCATGGGAATTGAAAGGTGGG - Intronic
1006383229 6:33713244-33713266 TACCAAAAGAATTGAAAGCAAGG - Intergenic
1007245008 6:40455151-40455173 AACCATGAGAATAAAGAGGAAGG - Intronic
1009862268 6:69349200-69349222 CAGCATGAGAATAGAAAGGAAGG - Intronic
1011822222 6:91266918-91266940 TACCATTAACATTGATAGAATGG - Intergenic
1012021284 6:93923652-93923674 TAACATCCAAATTGATAGGAAGG + Intergenic
1012438439 6:99239312-99239334 ACCAATGAGAATTGATAGAATGG + Intergenic
1013145883 6:107391297-107391319 TACCATGTGTAATGATAAGAGGG + Intronic
1015868903 6:137755760-137755782 TACAATGGGAAATGATGGGAGGG + Intergenic
1017081827 6:150676939-150676961 TAGTTTGAGAATTGATTGGATGG - Intronic
1017760117 6:157562195-157562217 AACCATGAGAAGAGAGAGGAAGG + Intronic
1018140191 6:160824799-160824821 TACCAAGAGAACTGAAAGGAAGG - Intergenic
1018740922 6:166728123-166728145 TACCATGCCATTTTATAGGAGGG + Intronic
1020521066 7:9188214-9188236 GACCATGAGAATTGATACTTTGG + Intergenic
1021057751 7:16071740-16071762 TACCATGAGGATTGGCAGAATGG - Intergenic
1023237200 7:38102057-38102079 TGGCATCAGAATTGCTAGGAGGG - Intergenic
1023766657 7:43517807-43517829 TTCTTTGAGAATTGATAGGGAGG - Intronic
1024585787 7:50841246-50841268 TACGTTCAGAATTCATAGGATGG - Intergenic
1024623942 7:51188321-51188343 TACCAAGAGGATTGAAAGTAAGG + Intronic
1027679358 7:81200486-81200508 TACCTTGAGAATTGTTTGGGAGG - Intergenic
1028801888 7:94975862-94975884 TACCTTTATAATTGAGAGGAAGG - Intronic
1030770118 7:113464141-113464163 TACCTGGAGAATGTATAGGAGGG - Intergenic
1031228825 7:119077763-119077785 TACCATAAGCATTAAGAGGATGG + Intergenic
1031366572 7:120907403-120907425 TAACTTGATAATTTATAGGATGG - Intergenic
1033828204 7:145218471-145218493 TGACTTGAGAATTGATAAGAAGG - Intergenic
1033997730 7:147372684-147372706 TCCCTTGAAAATTGATGGGAAGG + Intronic
1034731626 7:153392202-153392224 TACCATTAGAACAGAGAGGAAGG + Intergenic
1035440408 7:158892641-158892663 TTCCATCAAAATTGAGAGGAAGG + Intronic
1037518340 8:19655912-19655934 TACTATGCTAATTGAAAGGAGGG + Intronic
1037931344 8:22882178-22882200 TTCCCTGAAAAGTGATAGGATGG - Intronic
1040719397 8:50298926-50298948 AACCATAAGAAATAATAGGAAGG + Intronic
1041479342 8:58300423-58300445 AAGCATGAGAATTGATATCAGGG - Intergenic
1042851543 8:73221390-73221412 TACAATCAGAAATGATAAGAGGG - Intergenic
1042942695 8:74123913-74123935 TAACATGATAATGGATAGGGAGG - Intergenic
1043430575 8:80190626-80190648 TCCCATAAGAATTGATTGGATGG - Intronic
1044057784 8:87593802-87593824 TCACATCAGAATTGAAAGGAAGG + Intronic
1046909907 8:119614364-119614386 CACCATAAGAATTCCTAGGAGGG - Intronic
1047270307 8:123351663-123351685 TACTCTGAAAATTGATAAGAGGG - Intronic
1051000429 9:12275350-12275372 TACACTGAGAATTGACAGGAAGG + Intergenic
1051560429 9:18435489-18435511 TACTATGAGAATATATAGGAGGG + Intergenic
1055079544 9:72255718-72255740 TACCATGAGATTTTACGGGATGG - Intronic
1056154321 9:83818826-83818848 TAGCATGAGAATATATATGAAGG + Intronic
1056356186 9:85804300-85804322 TAGCATGAGAATATATATGAAGG - Intergenic
1058135113 9:101298896-101298918 TACCATGAGAATTGTTGAGTTGG + Intronic
1058961421 9:109995890-109995912 TGCCATGAGGATGGAGAGGAAGG + Intronic
1059412253 9:114139691-114139713 TACCAAGGGAGTTGAGAGGAAGG - Intergenic
1059688733 9:116663107-116663129 TAGCCTGAGAAGTGATTGGAAGG - Intronic
1186807104 X:13151313-13151335 TACCAAAAGAATTGAAAGTAGGG - Intergenic
1187630413 X:21163169-21163191 TACTATGACAATTGATGTGAAGG + Intergenic
1187658947 X:21516353-21516375 TCTCCTGAAAATTGATAGGATGG + Intronic
1188696052 X:33192056-33192078 TACCCTGGGAATTCAGAGGAAGG + Intronic
1188881359 X:35496033-35496055 ATGCATGAGAATTGAGAGGAAGG + Intergenic
1189293008 X:39899262-39899284 TACCATGAGGAGTGAAAGAAGGG + Intergenic
1189461941 X:41250164-41250186 TGCCATGACAATTGAGTGGAGGG - Intergenic
1192409617 X:70921443-70921465 TATCATGAGAATTCACATGACGG - Intergenic
1194436849 X:93876984-93877006 TACAATCAGAAGTGATAAGAGGG + Intergenic
1194524697 X:94965500-94965522 TACCATGATAACAGATAGGAAGG + Intergenic
1195942893 X:110179935-110179957 ATCCAGGAGAATTCATAGGATGG - Intronic
1197080330 X:122405326-122405348 TATCATGAGAATGTATAGAATGG + Intergenic
1197860943 X:130969490-130969512 TAACATAAGACTTGAGAGGAAGG + Intergenic
1198810581 X:140532019-140532041 TACAATGAGAACTGATTTGAAGG - Intergenic
1200736058 Y:6796933-6796955 TACAATCAGAAATGATAAGAGGG - Intergenic