ID: 1168238776

View in Genome Browser
Species Human (GRCh38)
Location 19:55078970-55078992
Sequence GGGGAGAAAGAGAATGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 896
Summary {0: 1, 1: 0, 2: 3, 3: 66, 4: 826}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168238776_1168238782 16 Left 1168238776 19:55078970-55078992 CCAGGCTCATTCTCTTTCTCCCC 0: 1
1: 0
2: 3
3: 66
4: 826
Right 1168238782 19:55079009-55079031 GCGTTACTCCACAGTTGTTATGG 0: 1
1: 0
2: 1
3: 3
4: 30
1168238776_1168238778 -9 Left 1168238776 19:55078970-55078992 CCAGGCTCATTCTCTTTCTCCCC 0: 1
1: 0
2: 3
3: 66
4: 826
Right 1168238778 19:55078984-55079006 TTTCTCCCCTGGCAGAGCAGAGG 0: 1
1: 0
2: 2
3: 30
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168238776 Original CRISPR GGGGAGAAAGAGAATGAGCC TGG (reversed) Intronic
900526153 1:3129815-3129837 AGGGGGAAAGAGAATCAGACAGG - Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901159392 1:7163406-7163428 GGAGAGGAAGAGAGTGACCCAGG + Intronic
902143940 1:14380771-14380793 GAGGAGATAGAGAAAGAGACAGG + Intergenic
902166038 1:14572368-14572390 AGGGAAGAAGAGAATGAGCTGGG + Intergenic
902959770 1:19954924-19954946 GGGAAGGAAGAGAAGAAGCCAGG - Intergenic
903134913 1:21302994-21303016 GGGCAGAAATAGCAGGAGCCTGG - Intronic
903748831 1:25606201-25606223 ACGGATAAAGAAAATGAGCCTGG + Intergenic
904333957 1:29785046-29785068 GGGGAGACAGAGAAGGAGGAGGG + Intergenic
904349308 1:29894537-29894559 GGCGAGAAGGAGGATGTGCCTGG - Intergenic
904746654 1:32715640-32715662 GGGGAGATAGAGCATTCGCCTGG - Intergenic
904995372 1:34627474-34627496 GGGGAGAAAGAACAGGATCCAGG + Intergenic
905225442 1:36475676-36475698 GGGGTGGAAGAGAATGGGCCAGG + Intronic
905364989 1:37446059-37446081 AGTGAGAGAGAGAATGAGCAGGG - Intergenic
906124542 1:43419651-43419673 GGAGAGAAAGAGACTGGGCTAGG - Intronic
906462684 1:46048260-46048282 GGGGAGATACAGGATGATCCTGG - Intronic
907380290 1:54081629-54081651 GGCAAGAAAGAGAAGGAGTCTGG - Intronic
908011574 1:59783621-59783643 GGGGAGAAACAGAAAGCGCCAGG + Intergenic
908205571 1:61844832-61844854 GGAGAGAGAGAGAATGAGGGGGG - Intronic
908260277 1:62334931-62334953 GGAGAGGAAGACCATGAGCCAGG + Intergenic
908358073 1:63341710-63341732 GAGGAGAGAGAGAAAGAACCAGG + Intergenic
908470363 1:64438233-64438255 GGGAGGAAAGAGAAAGGGCCAGG - Intergenic
909197476 1:72646397-72646419 GGGGAGAGAGAGAAAGAGAGAGG + Intergenic
909787645 1:79635823-79635845 GTGGAGAAAGAGGAGGAGACAGG + Intergenic
910210375 1:84786216-84786238 GGGGAGAGAGTGCAAGAGCCAGG + Intergenic
910228558 1:84962667-84962689 AGGGAGAAAAAGAATCACCCCGG + Intronic
910289534 1:85587145-85587167 GTGGAGAAAGAGAAAGGACCAGG + Intergenic
910391943 1:86754812-86754834 GGGGAGGAAAAGAATGCCCCTGG + Intergenic
910440646 1:87248127-87248149 AGAGAGAGAGAGAATGAGGCGGG + Intergenic
910573339 1:88730387-88730409 GAGCAGAAAGAGAGAGAGCCTGG - Intronic
911285804 1:95991003-95991025 GGAGAAAAATAGAATGGGCCCGG + Intergenic
911664135 1:100535114-100535136 GGGGAGCCAGAGACTGAGTCTGG + Intergenic
911720539 1:101186734-101186756 GGGGAGAAAGAGAAAGAAGAAGG - Intergenic
912249725 1:107998659-107998681 GGAGAGAGAGAGAAAGAGCGAGG - Intergenic
912772022 1:112472967-112472989 GGAGAGAAAGAGAAAGAGAGAGG + Intronic
913234221 1:116766180-116766202 AGGGAGAAGGACAATGAGCCTGG + Intronic
915983499 1:160439153-160439175 AGGAAGAAAGAGCATGGGCCTGG - Intergenic
916005748 1:160658540-160658562 GGGGAGAAAGAGAGCGCCCCAGG - Intergenic
916075047 1:161195800-161195822 GAGGAGACAGAGAAAGAGACGGG - Intronic
916290219 1:163157824-163157846 AGGAAGAAAGAAAATTAGCCAGG - Intronic
916332044 1:163628267-163628289 AGGGAGAGAGAGAATGAATCTGG - Intergenic
916452100 1:164930539-164930561 GGGAAGAAAGAGAAGGAGGGAGG - Intergenic
917243550 1:172975255-172975277 GGGGAGACAGAGACTGAGAAGGG - Intergenic
917387267 1:174491044-174491066 AGGGAGATAGAGCATGAGGCAGG - Intronic
917881328 1:179339488-179339510 GAGGATAAAGAGAATGAGGAGGG - Exonic
918029703 1:180793829-180793851 GGAGAGAAAGAAAATGAGGGTGG - Intronic
918141863 1:181726579-181726601 GGGGAAATAGAGAAAGGGCCAGG + Intronic
918144339 1:181742458-181742480 GGGCAGAAAGAGACTGGGACAGG - Intronic
918527539 1:185481202-185481224 GGGGAGAAAGATAAGGAACTTGG - Intergenic
918682710 1:187374834-187374856 GGGGCAAAAGAGAAGCAGCCAGG - Intergenic
919189241 1:194194681-194194703 GGAGAGAGAGAGAATGAGAGGGG - Intergenic
919673853 1:200362118-200362140 GGGGAGTAAGAGAGTCAGACTGG - Intergenic
919973061 1:202593146-202593168 AGGTAGAAAGAGATTGAGCCAGG - Exonic
920052522 1:203172371-203172393 GGGGAGACAGAGAGTCAGCTGGG - Intronic
920058218 1:203208103-203208125 GGGGAGAAAGAGGAGGATCTTGG + Intergenic
920107712 1:203566070-203566092 GGGGAGACAGAGATTTAGACAGG - Intergenic
920631725 1:207659268-207659290 GGGAAGGAAGGGAATGGGCCTGG - Intronic
920676144 1:208039970-208039992 GGTGAGAAAGGGAGTGAGACGGG - Exonic
920730206 1:208476376-208476398 AGGGAAAAAGAATATGAGCCAGG + Intergenic
920945240 1:210522818-210522840 GGGTAGAAAGAGAGCGTGCCAGG - Intronic
921181934 1:212638169-212638191 TGGGAGAAAGAGAGTGAGCTGGG - Intergenic
921270580 1:213465863-213465885 GGAGAGATAGGGACTGAGCCTGG - Intergenic
921295929 1:213703919-213703941 GAGGAGATAGAGAATGAGACAGG - Intergenic
921308799 1:213822722-213822744 TTGGAGAAAGAGAAGAAGCCAGG - Intergenic
921883091 1:220276038-220276060 TGGGGGAAAGCCAATGAGCCAGG - Intergenic
922519315 1:226234576-226234598 GCAGAGAAAGAAGATGAGCCCGG - Intronic
922648131 1:227311815-227311837 GGAGAAAAAGAGAATGAGTAGGG - Intronic
922677164 1:227560208-227560230 GGGGAAAAAGAGAAAGAGAGAGG - Intergenic
922818456 1:228468047-228468069 GGGGAGAATGGGACTGAGACAGG + Intergenic
923706018 1:236345504-236345526 GGGGGGAAAGAAAATGAGGGTGG - Intergenic
923893245 1:238238950-238238972 GGGGAGCAAGAGAGAGAGCAAGG + Intergenic
924468427 1:244318239-244318261 AGGTAAAAAGTGAATGAGCCAGG + Intergenic
1063001893 10:1932463-1932485 AGGGAGAGAGAGAAGGAGCTAGG + Intergenic
1063862749 10:10329519-10329541 GGTCAGAAAAAGAATGAACCTGG - Intergenic
1063972190 10:11389007-11389029 GGGGAGGAAGAGACTGAGAATGG - Intergenic
1064308439 10:14189276-14189298 GAGGAGGAAGAGAATGGGCCCGG + Intronic
1064502684 10:15991480-15991502 GAGGTGAAACAGAATAAGCCCGG - Intergenic
1064974525 10:21099718-21099740 AGGGAGAAAGACTGTGAGCCAGG + Intronic
1065423790 10:25577600-25577622 GAGCAAAAATAGAATGAGCCCGG - Intronic
1065549949 10:26860499-26860521 GGGGAGAGAGAAAATGGGCGAGG - Intronic
1065865124 10:29908309-29908331 GGGGAGAAAAAGAACCAGCCTGG + Intergenic
1065910898 10:30304644-30304666 GGGGAGAGAGAGAGAGAGACGGG + Intergenic
1066502434 10:36007104-36007126 AGGGAGAGAGAGAATGAGGGTGG - Intergenic
1067292041 10:44950591-44950613 GGGGAGAGAGAGAAGGAGTGTGG - Intergenic
1067704337 10:48595877-48595899 GGGGATCTAGAGAATGAGCCAGG + Intronic
1069282788 10:66676585-66676607 AGGGAGAAAGAGAGAGAGGCAGG - Intronic
1069739586 10:70678998-70679020 GAGGGGAAAGAGAAAGATCCAGG + Intronic
1069749920 10:70738747-70738769 GGATAGCAAGAGCATGAGCCTGG - Intronic
1069994804 10:72335686-72335708 GGGGAGAAAGGGAGGAAGCCTGG - Exonic
1070148254 10:73789930-73789952 AGGGAGAAAGAGACGGAGGCAGG - Intronic
1070448307 10:76530616-76530638 AGGGAGAAAGAGAACGAGAGAGG + Intronic
1070574858 10:77670329-77670351 GGGGAGGGAGAGAATGAGAGAGG + Intergenic
1070637976 10:78144572-78144594 TGCGAGAGAGAGAATGAGCAAGG - Intergenic
1070641232 10:78171842-78171864 AGGAAGTGAGAGAATGAGCCAGG - Intergenic
1070765981 10:79056688-79056710 AGGAAGAAAGAGGATGAGTCTGG + Intergenic
1071030355 10:81173127-81173149 GGGGTAAGAGAGAATGAGTCGGG - Intergenic
1071156044 10:82690919-82690941 TGGAAGAAAGAGAATGAGCAGGG - Intronic
1071327932 10:84535082-84535104 GGCAAGAGAGAGAATGAGCAGGG - Intergenic
1072204642 10:93192376-93192398 GAGGAGAAAGAGAGAGGGCCAGG + Intergenic
1072415459 10:95243045-95243067 GGGTAGAATGAGAAAAAGCCAGG + Intronic
1073003474 10:100303049-100303071 GGGGAAAGAGAGAATGAGAAAGG + Intronic
1073113152 10:101074557-101074579 GGGGACACAGAGAGTGAGACAGG + Intergenic
1073219671 10:101860207-101860229 GGGAAGAAAGAGAATGAAGTAGG + Intronic
1073840322 10:107491559-107491581 GGAGAGTGAGAGATTGAGCCTGG + Intergenic
1073878193 10:107950026-107950048 GGGGAGCAAGAGAAGGAGAGGGG - Intergenic
1074204437 10:111270487-111270509 GGGGAAAAAAATAATAAGCCAGG + Intergenic
1074377337 10:112951123-112951145 GGGGAGAAAAAGAATCGGCGAGG - Intronic
1074875689 10:117611455-117611477 AGGGAGAAAGAAACTGACCCAGG - Intergenic
1074957346 10:118405299-118405321 GGAAAGAAAGGGAATGAGCTGGG - Intergenic
1075398731 10:122146245-122146267 GGGGAGAAACAGCATGTGCATGG + Intronic
1076074417 10:127522063-127522085 GGGGAGAGCGAGAATGAGGATGG - Intergenic
1076944757 10:133638184-133638206 GTGGGGAGAGAGAATGGGCCGGG - Intergenic
1077083784 11:737267-737289 GGGGAAAAAAAGATGGAGCCGGG - Intergenic
1077160300 11:1109621-1109643 GAGGGAAAGGAGAATGAGCCCGG - Intergenic
1077511320 11:2965130-2965152 GAGGAGAAAGAGCAGAAGCCTGG + Intronic
1077665915 11:4108951-4108973 GGAGAGAAAAAAAAGGAGCCAGG - Intronic
1077724414 11:4659962-4659984 GGGGGGAATGAGAATGTTCCAGG + Intergenic
1077734573 11:4775775-4775797 AGAGAGAGAGAGAAGGAGCCAGG + Intronic
1077901805 11:6496186-6496208 GGGGAGAGAGAGAAAGAGAAAGG + Intronic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078452425 11:11450125-11450147 GGGAAGTAAGAGATGGAGCCAGG + Intronic
1078611055 11:12819965-12819987 GTGGAGAAACAGAATGGGCTGGG + Intronic
1079085883 11:17444537-17444559 GGGGAGCATGAGGAGGAGCCAGG - Intronic
1079623457 11:22584271-22584293 AGGGAGCAAGAGAAAGAGGCAGG - Intergenic
1080264757 11:30388962-30388984 GGGGAGAGAGAGAAAGAGAGAGG + Intronic
1080413392 11:32047383-32047405 AGGGAGAAAGAGAGAGAACCTGG - Intronic
1080573255 11:33576218-33576240 GGAGAGGAAGACCATGAGCCAGG - Intronic
1080792845 11:35536991-35537013 GGGGAAAGAGAGAATGAGAGAGG - Intergenic
1081220683 11:40456860-40456882 AGAGAGAAAGAGAAAGAGCATGG + Intronic
1081791930 11:45794323-45794345 AGGGAGAAAGGAAAAGAGCCGGG - Intergenic
1081841489 11:46204698-46204720 GGAGAGAAAGTCAGTGAGCCAGG + Intergenic
1082143730 11:48641563-48641585 GGAGAGAAAGAGAATCAGGTCGG - Intergenic
1082145339 11:48660292-48660314 GGGGAAAAAGTGAATATGCCAGG + Intergenic
1082298039 11:50468315-50468337 GGTGAAAAAGTGAATGTGCCAGG + Intergenic
1082570900 11:54738693-54738715 GGAGAGAAAGAGAATCAGGTAGG - Intergenic
1082597426 11:55100851-55100873 GGTGAAAAAGAGAATATGCCAGG + Intergenic
1082621095 11:55423076-55423098 GGAGAGAAAGAGAATCAGGTAGG - Intergenic
1082770943 11:57206964-57206986 GGGGAGAGAGAGACTGTCCCAGG - Intergenic
1082874550 11:57974804-57974826 GTGGAGAAAGAAAAGGAGGCAGG - Intergenic
1082961347 11:58921391-58921413 GGGCCCAAAGAGAAGGAGCCCGG + Intronic
1083590051 11:63888526-63888548 AGGGAGACAGAGAAAGAGGCGGG - Intronic
1084215828 11:67646372-67646394 GGGGAGACAGAGGAAGAACCGGG - Intronic
1084266040 11:68005635-68005657 GGGGAGGAAGAGATTGCACCAGG - Intergenic
1084270155 11:68024966-68024988 GGGGAGATACAAGATGAGCCTGG - Intronic
1084279321 11:68076939-68076961 GGAGAGGAAGAAAATGAGGCCGG + Intronic
1084470354 11:69355883-69355905 GGAGAGAGATAGAAGGAGCCAGG - Intronic
1084690132 11:70720329-70720351 GAGGCTACAGAGAATGAGCCTGG + Intronic
1084726613 11:70946294-70946316 GTGGAGAGAGAGGTTGAGCCTGG - Intronic
1084726735 11:70946769-70946791 GTGGAGAGAGAGGTTGAGCCTGG - Intronic
1084726753 11:70946841-70946863 GTGGAGAGGGAGGATGAGCCTGG - Intronic
1084941330 11:72614957-72614979 GGGGAGGAAGAGAAAGAGGGAGG - Intronic
1085204163 11:74720543-74720565 GGGGACTAAGAGAATAAGCTAGG - Intronic
1085527795 11:77174162-77174184 GGGGAGAAAGAGTAGAAGGCAGG - Intronic
1086336486 11:85806282-85806304 GGGGAGAAAGAGAAGGAAAAAGG - Intronic
1086398569 11:86442281-86442303 GGGAAGAAAGAGATTTACCCTGG + Intronic
1087776283 11:102259858-102259880 GGGGAGAAAAAGCATGATCCAGG - Intergenic
1088454431 11:110018818-110018840 GGGAAGAAAGATAATAAGCTTGG + Intergenic
1088712537 11:112521621-112521643 CGGGAGATGGAGAATGGGCCAGG + Intergenic
1089111118 11:116057491-116057513 GGGGAGGAGGAGAATGAGGTTGG + Intergenic
1089173779 11:116534166-116534188 GGGGAGGGAGAGAATGAGAGAGG + Intergenic
1089577287 11:119454109-119454131 GGGGAAAGAGAGCCTGAGCCTGG + Intergenic
1089667449 11:120029472-120029494 AGGGAAAAAGAGGAGGAGCCAGG + Intergenic
1089684019 11:120135383-120135405 TGGGAGAATGAGACTGAGCGTGG + Intronic
1089723495 11:120451703-120451725 GGAGGGAAAGAGAATGATACAGG + Exonic
1089891014 11:121880666-121880688 GGGGAGAAAGAGGATGACAAAGG + Intergenic
1089922156 11:122219594-122219616 GGGGGGAAAGAGAATTATTCAGG - Intergenic
1090049791 11:123367952-123367974 GGGGAGAAAGAGGAGGAGCCAGG + Intergenic
1090304716 11:125681348-125681370 GGGGAGAAAGAGAGCGAGACTGG + Intergenic
1090334437 11:125953373-125953395 GGGGACAGAGAGGATGAGGCCGG - Intergenic
1090937346 11:131354993-131355015 GGGGAGAGAGAGAAAGAGAGAGG - Intergenic
1091311496 11:134578183-134578205 TGGGAGTAAGAGAATAAGCTTGG + Intergenic
1091770234 12:3146665-3146687 GTGGAGAAAGATAAGGAGGCAGG - Intronic
1091991263 12:4957862-4957884 AGGGAGAAAGAGAAGGGGACAGG - Intergenic
1092031641 12:5291199-5291221 GGGCAGAAAGTAAATCAGCCAGG + Intergenic
1092112018 12:5970682-5970704 GAGGAGAAAGGCAATGGGCCTGG + Intronic
1092140120 12:6178083-6178105 GGGCAGGAAGAGAAAGAGACAGG - Intergenic
1092502832 12:9065133-9065155 GGGGAGGAAGGGAATGTTCCAGG - Intergenic
1093273414 12:17094439-17094461 AGGGAGAAAGAGTATGAACTTGG - Intergenic
1093861035 12:24167878-24167900 AGAGAGAAAGGGAAAGAGCCAGG + Intergenic
1094061274 12:26317324-26317346 GGGGAGAAAGAGAAAGAATAAGG - Intergenic
1094546329 12:31407758-31407780 CAGGAAAAAGACAATGAGCCTGG + Intronic
1094584704 12:31767428-31767450 GGGGAGGGAGAGAAAGAGGCTGG + Intergenic
1094701137 12:32871973-32871995 GGGGAGAGAGAGAAGGAGGGAGG - Intronic
1095154377 12:38834369-38834391 GGGGAGAAGGAGATTGAGGCAGG - Intronic
1095267757 12:40180267-40180289 TGGGAGAAAGCCAGTGAGCCAGG - Intergenic
1095389781 12:41692148-41692170 GGAGAGAAAGAGAGTGAGCGAGG - Intergenic
1095511632 12:42957040-42957062 TGGGACAGAGAGAATGAGCAAGG + Intergenic
1095854538 12:46845440-46845462 GGGGAAAAAGAGAGTGAGGAGGG + Intergenic
1095914344 12:47461085-47461107 GGGGGGACCGAGAAGGAGCCAGG + Intergenic
1096088489 12:48882660-48882682 AGGGAATAAGAGAAGGAGCCAGG + Intergenic
1096695583 12:53346077-53346099 GGGGAGGAGGAGAGGGAGCCAGG + Intergenic
1096910122 12:54974746-54974768 GGAGAGACAGAAAATGAGCTAGG - Intronic
1097362295 12:58671319-58671341 GTGGTGAAAGACAATGACCCTGG + Intronic
1098086324 12:66848235-66848257 AGGGAGACAGGGAAAGAGCCAGG - Intergenic
1098445633 12:70563119-70563141 GAGGAGCAAGAGAATGAGGGAGG + Intronic
1098841492 12:75483504-75483526 GGAGAAATAGGGAATGAGCCAGG + Intronic
1099013772 12:77322366-77322388 GGAGTGAAAGAGAATGAGAGCGG - Intergenic
1099609937 12:84855873-84855895 GAGGAGATAGAGAAAGAGACAGG - Intergenic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1100035616 12:90247807-90247829 AGAGAGAGAGAGACTGAGCCAGG + Intergenic
1100773233 12:97947109-97947131 GGGAAGAAAGAAAAAGAGGCTGG + Intergenic
1101012733 12:100467698-100467720 AGAGAGAAAGAGAAAGAGCATGG - Intergenic
1101138312 12:101769021-101769043 GGGGAACAGGAGAATGGGCCTGG + Intronic
1101234849 12:102778150-102778172 GAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1101333556 12:103776959-103776981 TGGAAGAAAGAAAATGAACCAGG - Exonic
1101502899 12:105320538-105320560 AGGGAGAAAGGGAAGGAACCAGG + Intronic
1101547575 12:105730915-105730937 TGGGAGAAAGAGAAGGAAACTGG - Intergenic
1101563259 12:105880413-105880435 GGGGTGGAAAAGAATGAGCAAGG + Intergenic
1101580552 12:106037908-106037930 GAGGAGAAAGAGAAGGAGAGAGG - Intergenic
1101851535 12:108406948-108406970 AGAGAGAGAGAGAATGAGGCAGG + Intergenic
1101941908 12:109105691-109105713 GGGGAGAAAGAGAGGTAGGCAGG - Intronic
1102396218 12:112588664-112588686 GTGGAGAGAGAGAAAGAGCGAGG - Intronic
1102508780 12:113400310-113400332 AAGAAGAAAGAGAATTAGCCAGG + Intronic
1102941478 12:116946512-116946534 GGGGAGGAAGAGAATGCTACTGG - Intronic
1103034680 12:117646954-117646976 GAGGAGAGGGAGAAAGAGCCAGG + Intronic
1103722412 12:122981858-122981880 GGGGAGGAAGAGGATGGCCCAGG + Exonic
1103886790 12:124208446-124208468 GGGGAGGAGGAGAGGGAGCCAGG - Intronic
1103929059 12:124439586-124439608 GGTGAGAAAGAGACAGAGACTGG + Intronic
1104160504 12:126175217-126175239 GGAGAGATATAGAATGAACCTGG - Intergenic
1104239266 12:126971712-126971734 GGGGAGAAAGAGAAGGAGGAAGG - Intergenic
1105703397 13:22950793-22950815 GAGGAGAAATAGAAGGAGACAGG + Intergenic
1106353816 13:28959642-28959664 AGGGAGAAAGAGGAGGTGCCAGG + Intronic
1106768284 13:32937890-32937912 TGGGAGACAGAGGATGTGCCAGG - Intergenic
1107312172 13:39090885-39090907 GGGTAGAAAGTGACTGAGCTGGG + Intergenic
1107560224 13:41551481-41551503 GAGGACACAGAGAAGGAGCCAGG - Intergenic
1107565977 13:41604953-41604975 GGGCAGAAAGAGGAGGAGACAGG + Intronic
1109109869 13:58303266-58303288 GGGTAGAAAGACAATGAACATGG - Intergenic
1109207589 13:59499458-59499480 GTGGAGAGAGAGAATGAAACTGG - Intergenic
1109208085 13:59504076-59504098 GAGGAGAAAGGAAATGATCCAGG - Intergenic
1110572000 13:77014527-77014549 GGGAGAAAAGAGAATGAGCAAGG + Intronic
1110623925 13:77630136-77630158 GGGGAGAATGAGACTGAGACAGG + Intronic
1111982065 13:95026726-95026748 GGGGGGAAAAAAAATTAGCCAGG + Intronic
1112467441 13:99656186-99656208 TGGGAGTGATAGAATGAGCCAGG + Intronic
1112497530 13:99916522-99916544 AGGGAGGAAGGGAATGAGCTTGG - Intergenic
1112724319 13:102284944-102284966 GGTGAGAAAGAGAAAGAGGGAGG - Intronic
1113064418 13:106358980-106359002 AGGGAGAGAGAGAAGGAGCATGG - Intergenic
1113290984 13:108905985-108906007 GGGCACAAAGTAAATGAGCCAGG - Intronic
1113585121 13:111459637-111459659 AGGGAGAAAGAGAAAGAGAAGGG + Intergenic
1113585126 13:111459657-111459679 GGGGAGAGAGAGAAGGAGAGGGG + Intergenic
1115301308 14:31888310-31888332 GGAGAGAAAGAGAAAGAGAGAGG - Intergenic
1115688474 14:35821086-35821108 GGAGAGAATGACACTGAGCCAGG + Intergenic
1116485655 14:45444948-45444970 TGAGAGAAAGAGAATGGGCAAGG - Intergenic
1116808403 14:49515861-49515883 GGGCAAACTGAGAATGAGCCAGG - Intergenic
1117679293 14:58186868-58186890 GGTGAGAAACAGAAGGAGGCAGG + Intronic
1117763002 14:59052054-59052076 GGAGAGAAAGAGAAAGAGGAAGG - Intergenic
1117791789 14:59349493-59349515 GGGGAGGAAAAGAAAGAGCGTGG - Intronic
1118078557 14:62329960-62329982 GGGAAGAAGGAGAATGTGCTAGG + Intergenic
1118167667 14:63353818-63353840 GTGGAGAGAGAGCAGGAGCCAGG - Intergenic
1118471197 14:66076903-66076925 GGGGAGAAAGAGTTTAAACCAGG + Intergenic
1118817842 14:69325303-69325325 GTGGAAACAGAGAAAGAGCCTGG - Intronic
1118823104 14:69357930-69357952 GGAGAGAATCAGAATGAGCTGGG + Intergenic
1119227364 14:72954587-72954609 GGGGAGAAAGAGCATCAGAAAGG + Intronic
1119371012 14:74143251-74143273 TGACAGAAACAGAATGAGCCTGG + Intronic
1119379909 14:74221937-74221959 GGGGAGAAAAAGCCTGAGGCCGG + Intergenic
1119664734 14:76477241-76477263 GGGGAGAAATAGAGCAAGCCAGG + Intronic
1119669628 14:76508607-76508629 GGGGAGAAAGAGAGAGAGAGAGG + Intergenic
1120059881 14:79969993-79970015 GGGAAGAAAGAAAATGTTCCAGG + Intergenic
1120677914 14:87443432-87443454 GGGGAGAGAGAGAAAGAGGGAGG + Intergenic
1120706908 14:87754869-87754891 AGAGAGACAGAGAAAGAGCCTGG + Intergenic
1120716124 14:87842496-87842518 GGAGACACAGAGAATGAGCATGG - Intronic
1120796174 14:88635668-88635690 GGGATGGAAGAGAATGAGACAGG - Intronic
1121585634 14:95061229-95061251 GGGGAGACAGAGACAGAGACTGG - Intergenic
1121672703 14:95725016-95725038 GGGGAGTAAGAGAAAGAGGGAGG - Intergenic
1121695545 14:95909241-95909263 GGGGAGAAAGAAAATAAACAAGG + Intergenic
1122020945 14:98837448-98837470 GTGGAGAAAGAGTGTGAGCCTGG - Intergenic
1122159696 14:99774109-99774131 GGGCAGAAAGAGCCTGGGCCAGG + Intronic
1122266359 14:100548721-100548743 GGGGAGGCAGACAATGAGCTAGG + Intronic
1122447955 14:101782348-101782370 GGGGAGAAAGAGAGAGAGAAGGG - Intronic
1122448071 14:101782665-101782687 GGGGAGAAAGAGAGAGAGAAGGG - Intronic
1122787936 14:104172549-104172571 GGGGGGCAAGAGAATCAGGCAGG - Intronic
1123140655 14:106074133-106074155 GGGGAAAGAGAGAAAGAGCAAGG - Intergenic
1123158443 14:106253005-106253027 GGAGAGAGAGAGAAAGAGCAAGG - Intergenic
1124102938 15:26712720-26712742 GGGGAGAGAAAGAAGAAGCCAGG + Intronic
1124589430 15:31040349-31040371 GGGGGGAAAGAGAAGGGACCAGG + Intronic
1124673137 15:31659179-31659201 GGGTAGATGGAGAATGAGACTGG + Intronic
1125927237 15:43572917-43572939 TGGGAGTCAGAGAATGAGCAGGG + Intronic
1125940380 15:43672482-43672504 TGGGAGTCAGAGAATGAGCAGGG + Intergenic
1126049803 15:44675523-44675545 GAGGAGGAAGAGAATGATCTTGG - Exonic
1127553712 15:60066428-60066450 GCAGAGAGACAGAATGAGCCAGG - Intergenic
1128352893 15:66903235-66903257 TGGTAGAAACAGAATGAGCTGGG + Intergenic
1128374060 15:67063331-67063353 GGGGAAGAAGAGAAAGAGCCGGG + Intergenic
1128410614 15:67393278-67393300 TGGGAGAAAGAGAACTAGACTGG - Intronic
1128526601 15:68416391-68416413 AGGGAGACAGAGAACGAGCAAGG + Intronic
1128697929 15:69782246-69782268 GGGAACACAGAGAATCAGCCAGG + Intergenic
1128892944 15:71347167-71347189 AGAGAAAATGAGAATGAGCCGGG - Intronic
1128939956 15:71779818-71779840 GGGGAGAAAGTGCATAAACCAGG + Exonic
1129231359 15:74198920-74198942 GTGGAGAAAGGGAGTGAGGCAGG + Intronic
1129257030 15:74339439-74339461 GAGGAGAAAGAAATAGAGCCAGG - Intronic
1129314438 15:74732688-74732710 GAGGAGGAAGAGAATGAGGCAGG - Intergenic
1129654271 15:77513296-77513318 AGAGAGAAAGAGAAAGAGACAGG - Intergenic
1129690607 15:77711172-77711194 GGGGAAGAAGAGAAAGATCCAGG - Intronic
1130928733 15:88404945-88404967 AGGGAAAAAGAGACTGAGGCAGG + Intergenic
1131399041 15:92110014-92110036 GAGGAGAAAGGGAATCAGGCTGG + Intronic
1131439332 15:92447220-92447242 GGAGAGAAAGAGAAAAATCCAGG + Intronic
1131548359 15:93334338-93334360 GGGGAGAAAGGCACTGTGCCAGG + Intergenic
1131639104 15:94270589-94270611 GGGGAGATGGAGAAAGAGCAAGG - Intronic
1131772210 15:95750647-95750669 AGGGAGAGAGAGAAGGTGCCAGG + Intergenic
1131902159 15:97099655-97099677 GGAGAGAAAGACCATGAGCCAGG - Intergenic
1131937934 15:97527562-97527584 AGGGAGAAAGAGAAAGATTCGGG + Intergenic
1132345543 15:101106386-101106408 AGGGAGAGAAAGAATGAGGCCGG + Intergenic
1133202529 16:4212858-4212880 GAGGAGAGAGGGACTGAGCCTGG - Intronic
1133218292 16:4306799-4306821 GGGGAGAAAGGGTGGGAGCCGGG - Intergenic
1133358964 16:5158465-5158487 CGGGAGCAAGAGAATGAGGAGGG - Intergenic
1133563597 16:6971942-6971964 CGGGAGAATGTGAATGAGCATGG + Intronic
1133640550 16:7712772-7712794 GGGAAGAAAGAGTAGGAGCAGGG + Intronic
1133668264 16:7992421-7992443 GGAGAGAAAGAGAAGGAGGAAGG + Intergenic
1133690458 16:8209662-8209684 GAGGAAAAAGAGGAGGAGCCAGG + Intergenic
1133760815 16:8797165-8797187 GCGGAGAAGGAGAAGGAGCGAGG + Intronic
1133844968 16:9445042-9445064 TGGGTGAATGAGAATCAGCCAGG - Intergenic
1134016358 16:10891240-10891262 GGGGGGAAAGAGCACCAGCCTGG + Intronic
1134817577 16:17218712-17218734 GGAGAGAAATTGAATGAGCTTGG - Intronic
1135215755 16:20566199-20566221 GGAGAGAGAGAGCATGAGCTTGG - Intronic
1135566746 16:23516962-23516984 GTGGAGAGAGAGAAGGACCCTGG + Intronic
1135600140 16:23775923-23775945 GGGGAGGAAGAGAGTGCGGCAGG - Intergenic
1136120939 16:28133748-28133770 GGGGAGAGAGAGAGAGATCCAGG + Intronic
1136154445 16:28373824-28373846 GGAGAGAAAGAGACGGAGTCTGG + Intergenic
1136361273 16:29781333-29781355 AGGAAGAAAGAGAAAGAGGCTGG + Exonic
1136366325 16:29810859-29810881 GGGGAGCAGGAGGAAGAGCCAGG + Exonic
1136574498 16:31115517-31115539 GGGGGGAAAGAAAAGGAGGCTGG - Intergenic
1136646392 16:31621597-31621619 GGGCAGAAAGAGAAAGAGGTTGG + Intergenic
1137598205 16:49738676-49738698 GCGGAGAAAGTGAGAGAGCCAGG + Intronic
1137885167 16:52095342-52095364 AGAAAGAAAGAAAATGAGCCAGG + Intergenic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1138299262 16:55912612-55912634 GAGGAGGAAGAGAAGGAGCAGGG + Intronic
1138534723 16:57653772-57653794 TGGGAGAGAAAGAATGAGCTGGG - Intronic
1138564813 16:57825264-57825286 AGGGACAAAGAGAAGGAGCCTGG - Intronic
1139341605 16:66271203-66271225 GGGGAGAAAAGGAATGAGAGGGG + Intergenic
1139481091 16:67231105-67231127 GGGGAGAAGGGGGAGGAGCCAGG + Intronic
1140176921 16:72670774-72670796 GTTGAGAAAGAGAACGGGCCTGG - Intergenic
1140644607 16:77015796-77015818 GGGGAGAAGGAGAAAGACCAAGG + Intergenic
1140728943 16:77838843-77838865 GGGGAGAAAGAGAAGGAGGAAGG - Intronic
1140763833 16:78137345-78137367 GGGGTGAAAGATACTGTGCCAGG - Intronic
1141348498 16:83270990-83271012 GGGGAGGAAGGGAATGAGAGAGG - Intronic
1141534335 16:84668692-84668714 GGAGAGAGAGAGAAAGAGACTGG - Intergenic
1141892687 16:86937293-86937315 GGGGTGAAAAAGAAAGAGGCGGG - Intergenic
1142183488 16:88683251-88683273 GGGGAAAAAAAAAATTAGCCAGG - Intronic
1142250722 16:88990616-88990638 GGGAAGGAAGAGAAAGAGCCAGG + Intergenic
1203013383 16_KI270728v1_random:323489-323511 GGGGAAAAAGAGAATGTCCAAGG + Intergenic
1203031718 16_KI270728v1_random:596648-596670 GGGGAAAAAGAGAATGTCCAAGG + Intergenic
1203040003 16_KI270728v1_random:737783-737805 GGGGAAAAAGAGAATGTCCAAGG - Intergenic
1142672914 17:1495655-1495677 GTGGAGAGAGCAAATGAGCCTGG + Exonic
1142972789 17:3623987-3624009 CGGGAGAATGAGAATAGGCCGGG - Intronic
1143238230 17:5421304-5421326 GGAGAGAATGAGAAACAGCCGGG + Exonic
1143296422 17:5875033-5875055 GGGAAGAGAGAGAAAGAACCAGG - Intronic
1143405931 17:6677260-6677282 CTGGAGAAAGAGCAGGAGCCAGG - Intergenic
1143863697 17:9908955-9908977 GGGGAGACAGAGAATGGGGAAGG + Intergenic
1144175023 17:12696903-12696925 AGGGAGGAATAGGATGAGCCAGG + Intronic
1144190748 17:12843240-12843262 GGGGAGAAACAGAGGGAGGCAGG - Intronic
1144430350 17:15185542-15185564 GGGTGGAAGGAGAATGAGACTGG + Intergenic
1144534867 17:16078433-16078455 GGGAAGAAAGAGTATGAACTGGG - Intronic
1144840347 17:18182270-18182292 GGGGAGAGAGAGAGGGAGACGGG + Intergenic
1145261877 17:21359344-21359366 TGGCAGAAAGAGAGTGTGCCTGG + Intergenic
1145758320 17:27409003-27409025 GTGGAGAAAGAGAAGGGACCAGG - Intergenic
1146607404 17:34272503-34272525 GGTGAGAAAAAGAATGAGTTTGG - Intergenic
1146787031 17:35729904-35729926 GAGGAGAATGGGTATGAGCCTGG - Intronic
1147142735 17:38468451-38468473 GGGGAGAAAGAGCAAGATGCAGG + Intronic
1147879002 17:43642036-43642058 GGGGAGGAAGCAAAGGAGCCTGG + Intronic
1148018076 17:44536573-44536595 GGACAGAGGGAGAATGAGCCAGG - Intergenic
1148664017 17:49361672-49361694 GGGGCGAAAGAGCAGGAGCGGGG + Intronic
1148769712 17:50059902-50059924 AGGGAGAGAGAGAATGAGAAAGG - Intronic
1148797835 17:50205701-50205723 GGGAAGAAAGAGAAAGAGCAGGG - Intergenic
1148830804 17:50429811-50429833 GGGGAGAAAGACTCTGGGCCGGG - Intronic
1148870334 17:50655455-50655477 TGATAGAAAGAAAATGAGCCTGG + Intronic
1149030230 17:52074055-52074077 GGGGAGAAGGAGGGTGAGTCAGG - Intronic
1149417580 17:56476029-56476051 CGGGAGAAAGAGAGTGAGGCAGG + Intronic
1150554519 17:66242023-66242045 AGGGAGCAAGAGAAGGAGCTGGG - Intronic
1150608746 17:66716128-66716150 GGGGAGATAGAAAATGGGCTGGG - Intronic
1151290712 17:73147958-73147980 GGGGAGAGAGAGAGAGAGACGGG - Intergenic
1151290787 17:73148330-73148352 GGGGAGAGAGAGAGAGAGACGGG - Intergenic
1151342441 17:73480675-73480697 AGGGAGAAAGAGAGAGAGACAGG + Intronic
1151439916 17:74121716-74121738 AGGGAGACAGAGAATGAGACAGG + Intergenic
1153565560 18:6414605-6414627 AAAGAGAAAGAGAAAGAGCCTGG + Intronic
1154058518 18:11035292-11035314 GGAGAGAGAGAGAAGGTGCCAGG - Intronic
1154337003 18:13474066-13474088 GGAGAGAAAGAGCACGAGGCGGG - Intronic
1154503592 18:15009947-15009969 GGGGAGGAAGAGAAGGAGGCAGG + Intergenic
1155646759 18:28087937-28087959 GGGGAGGAAAAAAATGAGGCGGG - Intronic
1155696336 18:28691178-28691200 AGAGAGAAAGAGAGAGAGCCAGG - Intergenic
1156453174 18:37278201-37278223 GGGGAGGAAGAGGGGGAGCCTGG - Intronic
1157320070 18:46627617-46627639 GGGTTGAAAGAGAATGTGGCTGG + Intronic
1157702129 18:49768077-49768099 AGGAAGAGAGAGAAGGAGCCAGG - Intergenic
1157888512 18:51392135-51392157 GGAGAGAAAGAAGATGAGTCTGG + Intergenic
1157990215 18:52486632-52486654 GCGATGAAAGAAAATGAGCCAGG - Intronic
1158226602 18:55207820-55207842 GGAGAGAAAGAGACTGGGGCAGG - Intergenic
1158385828 18:56990522-56990544 GGGGAAAAAGAAGATGAACCTGG + Intronic
1158464238 18:57675692-57675714 AGAAAGAAAGAGAATAAGCCAGG - Intronic
1158465957 18:57690104-57690126 GGTCAGAAACAGAATGAGTCAGG + Intronic
1159949409 18:74470609-74470631 GGAGAGAGAGAGAAAGAGCAGGG - Intergenic
1160696498 19:487383-487405 GGGAAGAGAGACCATGAGCCAGG - Intergenic
1161121962 19:2532528-2532550 GAGGAGAGAGAGAATGAAGCAGG + Intronic
1161501433 19:4618228-4618250 GGGGAGAGAGAGAAAGAGAGGGG - Intergenic
1161501438 19:4618249-4618271 GGGGAAAGAGAGAATGAGAAAGG - Intergenic
1161610510 19:5239634-5239656 GAGGAGAGAGAGATTGAGACAGG + Intronic
1161848314 19:6725060-6725082 GGGGAAAATGAGAAGGGGCCAGG + Intronic
1161959429 19:7515861-7515883 GGAGAGAAAGAGATAGGGCCAGG + Intronic
1162145019 19:8608260-8608282 GGGGTCAAAGAGGAGGAGCCGGG + Exonic
1162200841 19:9018853-9018875 GGGGATAAAGAGAAGGAACAAGG + Intergenic
1162709886 19:12585050-12585072 GGAGAGCAAGAAAAGGAGCCTGG + Intronic
1162783059 19:13017172-13017194 GGTGAGAAAGAAAGGGAGCCGGG + Intronic
1162863503 19:13526061-13526083 GGAGAGAGAGAGAATGAAGCTGG + Intronic
1162991757 19:14307416-14307438 GGGGAGAAGAAAAATGAGACAGG - Intergenic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163386757 19:17004695-17004717 GGGGATGGAGTGAATGAGCCGGG - Intronic
1164398459 19:27886638-27886660 TGAGAGAAAAAGAATGTGCCTGG + Intergenic
1164972248 19:32542560-32542582 GAGGAGAAAGAGAATGAAGTAGG + Intergenic
1165050290 19:33137089-33137111 AAGAAGAAAGAAAATGAGCCAGG - Intronic
1166159256 19:40939462-40939484 AGGGAGAGAGAGAATGAATCAGG + Intergenic
1166335878 19:42106863-42106885 GAGGAGAAGGAAAATTAGCCAGG + Intronic
1166917971 19:46208721-46208743 GGAGAGAAAGAGAGCGAGCCGGG - Intergenic
1166920265 19:46224408-46224430 GGAGAGAAAGAGAGGGAGCAGGG - Intergenic
1167081384 19:47278392-47278414 GAGAAGAAAGAGAATCAGCTGGG - Intergenic
1167119594 19:47508571-47508593 GGGTAGAAAGAGAATGACTTTGG + Intronic
1167206623 19:48106806-48106828 GCAGAGAAAGAGAAAGAGCGAGG - Intronic
1167270203 19:48502025-48502047 GGAGAGAAGGAGGAGGAGCCAGG - Intronic
1167361531 19:49032868-49032890 TGGGAGAATGAGCATGTGCCTGG - Intronic
1167364536 19:49047986-49048008 TGGGAGAATGAGCATGTGCCTGG + Intronic
1167365822 19:49054622-49054644 TGGGAGAATGAGCATGTGCCTGG + Intronic
1167621341 19:50562697-50562719 GAGGAGGAAGAGAGTGAGGCAGG - Intronic
1167706430 19:51083931-51083953 TGGGAGAAAGAGGATGGGACAGG + Intronic
1167854284 19:52225675-52225697 AGGGAGAGAGAGGGTGAGCCAGG - Intronic
1168238776 19:55078970-55078992 GGGGAGAAAGAGAATGAGCCTGG - Intronic
1168691763 19:58381678-58381700 GAGAAGAAAGAAAATTAGCCGGG - Intergenic
926375104 2:12219471-12219493 AGAGAGAGAGAGAATGAGCTGGG + Intergenic
926572934 2:14549739-14549761 GGGGAAAATGTGGATGAGCCCGG + Intergenic
926808788 2:16738048-16738070 GGGGAGATAGAATATGAGCTGGG + Intergenic
927715287 2:25347966-25347988 GGGAAGAAAGAGAGAGAGCAGGG - Intergenic
927875858 2:26654841-26654863 AGAGAGAGAGAGAATGAGTCTGG + Intergenic
928097083 2:28411354-28411376 GGGGAGTAAGAGAAGGAGAGAGG + Intronic
928105278 2:28466682-28466704 GTGGAGAAAGCAAATGAACCTGG + Intronic
928105825 2:28470055-28470077 GGGGAGAAAGAGGAGGAGGAAGG + Intronic
928113009 2:28525621-28525643 GGGTAGAATGAGACTGAGCCTGG - Intronic
928133396 2:28669697-28669719 GGGGAGAAGGGTGATGAGCCTGG + Intergenic
928843613 2:35641657-35641679 GGTGAGAAACAGGATGAGCATGG + Intergenic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
929771264 2:44894158-44894180 GGGGAAGAAGAGGAGGAGCCAGG + Intergenic
930158317 2:48127751-48127773 GGGGAGAGAGATAATGACTCTGG + Intergenic
930203274 2:48564361-48564383 TGGCAGAAAGAGAGTGAGCTAGG + Intronic
930840573 2:55840835-55840857 GGGGAGAAAGATAATGGGTTTGG - Intergenic
931263252 2:60638411-60638433 GGTGAGAAAGAGCCTGGGCCTGG - Intergenic
931348836 2:61470840-61470862 GGGGAGCAAGAGAATGGGGGAGG + Intergenic
931781141 2:65580166-65580188 GTGGAGAAAGAAAAGGAGGCAGG - Intergenic
932513027 2:72314494-72314516 GGAGAGAAAAACTATGAGCCAGG - Intronic
932850217 2:75177269-75177291 GGGGATGAAGACAATGAGCCAGG - Intronic
933238491 2:79892623-79892645 GGAAAGAAAGAGAAAGAGACAGG + Intronic
933291286 2:80441160-80441182 GGGTGGAAGGAGAAAGAGCCAGG + Intronic
933331343 2:80896555-80896577 GGGAAGGAAGAGAGTGAGGCAGG - Intergenic
934725148 2:96611984-96612006 GGGGAGAAAGAAAATGAGCAGGG + Intronic
934980852 2:98838809-98838831 GGTGAGAAAAACAATGAGACTGG + Intronic
935064127 2:99633446-99633468 GGGAGGAAAGAAAAGGAGCCAGG + Intronic
935209041 2:100922711-100922733 CAAGAGAAAGAAAATGAGCCTGG - Intronic
936345458 2:111672075-111672097 AGGGAGAGAGAGAAGGAGACTGG - Intergenic
937029686 2:118728167-118728189 GGGCAGGAAAAAAATGAGCCTGG + Intergenic
937097258 2:119243422-119243444 GGGGAGGAAGAGCAGGAGGCAGG - Intronic
937649776 2:124307034-124307056 CGGGAGAAAGAGAATTAGATGGG - Intronic
938304553 2:130243192-130243214 GGGAAAAAAGAGAATGTGCCTGG + Intergenic
938502766 2:131840078-131840100 GGGGAGGAAGAGAAGGAGGCAGG + Intergenic
938666710 2:133546269-133546291 CAGGAGAAAGAGAAAGAGTCAGG + Intronic
939090575 2:137775847-137775869 GGGGAGAATGAGACAGAGACAGG + Intergenic
939370053 2:141287234-141287256 GAGGAGAATGAGAATGAGAATGG - Intronic
940015077 2:149095746-149095768 AGGGAGAGAGAGAAAGAGGCAGG + Intronic
940362896 2:152814722-152814744 TGGGGGAAAGACAGTGAGCCAGG - Intergenic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
942022026 2:171875499-171875521 GGGGAGAGAGAGAAAGGGCAAGG + Intronic
942374937 2:175327302-175327324 TGGGAGAAAGAGAATTAGGGAGG + Intergenic
942454303 2:176127699-176127721 GGGGGGAAAATGAAAGAGCCTGG - Intergenic
944316332 2:198289370-198289392 GAGGGGAAAGAGAAAGAGACAGG - Intronic
944388759 2:199194931-199194953 GAGGAGGAGGAGAATGAGCAGGG - Intergenic
944934283 2:204551544-204551566 GGAGAGAAAGAGAAAGAGGAGGG - Intronic
945371863 2:209028667-209028689 AGGGAGAAAGAGAAGGAGAGAGG + Intergenic
946153418 2:217791293-217791315 CTGGAGAAAGAGAATGAGAAAGG - Intergenic
946159298 2:217826361-217826383 TGGGAGAGAGAGAAAGAGCCAGG - Intronic
946483462 2:220078454-220078476 GAGGAAGAAGAGAAGGAGCCTGG + Intergenic
946596074 2:221307482-221307504 GGAGAGAAAGGGAAAGAGGCTGG - Intergenic
947308124 2:228770120-228770142 GGAGACAAAGATAATGACCCAGG + Intergenic
947951104 2:234148120-234148142 GGAGAGAAAGAGGAAGACCCTGG - Intergenic
948220810 2:236268291-236268313 TGGGAGGATTAGAATGAGCCCGG - Intergenic
948274455 2:236697381-236697403 TGGAAGTGAGAGAATGAGCCAGG + Intergenic
948295135 2:236855157-236855179 TGGGAGAAGGAGGATGAGGCAGG - Intergenic
948439600 2:237978288-237978310 GGTGAGCAAGGCAATGAGCCAGG - Intronic
1169681057 20:8214387-8214409 GGAGCAAAAGAGAAAGAGCCAGG - Intronic
1169851549 20:10057238-10057260 GGGAAGAGAGAGAATGAAGCAGG + Exonic
1169961976 20:11170512-11170534 CGGGGGAAAGAAAATGAGCAAGG - Intergenic
1170150495 20:13221692-13221714 GGGGAGGAGGAGTAGGAGCCCGG - Intergenic
1170220182 20:13933734-13933756 AGACAGAAAGAGAAAGAGCCTGG + Intronic
1170369175 20:15629989-15630011 GGGAAGAAAAAGAATGAGAACGG - Intronic
1170493731 20:16904181-16904203 TGGGAGAAAGACCAGGAGCCTGG + Intergenic
1170916908 20:20635133-20635155 GAGGAGAATGAGGAGGAGCCAGG + Intronic
1171012050 20:21514133-21514155 GGGGAGAAAGAGAGGGAGGGAGG + Intergenic
1171038823 20:21740963-21740985 AGAGAGAAAGAGAAAGAGACAGG + Intergenic
1171084093 20:22219958-22219980 CTGGAGAAAGATAAGGAGCCAGG - Intergenic
1171131620 20:22658879-22658901 GGGGAGAAGTAGAATGATTCTGG + Intergenic
1171354544 20:24534055-24534077 GGGGAGCAAGAGAAAGAGGAGGG + Intronic
1171405802 20:24911735-24911757 GGAGAGAAAGTGAGTGAGGCGGG + Intergenic
1171846455 20:30280414-30280436 GGGGAGACAGAGCAAGAGGCAGG - Intergenic
1171886888 20:30660498-30660520 GGGGAGGAACAGAGTGGGCCAGG - Intergenic
1172504296 20:35450005-35450027 AGAGAGAGAGAGAATGGGCCGGG + Intronic
1172689867 20:36782982-36783004 GGGGAGAGGGAGAAAGAGCCTGG + Exonic
1172925051 20:38526360-38526382 CGGGAGGAAGAGAAAGAGGCAGG - Intronic
1173067818 20:39729762-39729784 GGGGAGAGAGAGAGAGAGACAGG - Intergenic
1173476832 20:43365572-43365594 GTGGAGAAAGGGACAGAGCCTGG - Intergenic
1173602862 20:44308492-44308514 TGGGAGAAACAGCATGAGTCTGG - Intronic
1173818212 20:46003738-46003760 GAGGTGAAAGAGAATGGGCCTGG - Intergenic
1174213369 20:48897803-48897825 GGAGAGGAAGAGAGAGAGCCAGG - Intergenic
1174283280 20:49454598-49454620 GTGGAGAAAAAGAATGAAGCAGG + Intronic
1174390586 20:50216296-50216318 AGAGAGAAAGAGAAAGAGACAGG + Intergenic
1174532060 20:51222038-51222060 GGAGAGAGAGAGAGAGAGCCAGG + Intergenic
1174666030 20:52258576-52258598 AGGAAGAAAGAGAATGAGAGGGG - Intergenic
1175293733 20:57894868-57894890 TGGGAGAAAGAAAATGAGGGAGG + Intergenic
1175672718 20:60919935-60919957 GGGGAGAGAGAGACTGAGAGAGG - Intergenic
1175689433 20:61054868-61054890 GGGGTGACAGAAAATGAGCAAGG - Intergenic
1175922586 20:62457108-62457130 GGCTAGGAAGAGAATGTGCCGGG - Intergenic
1176034551 20:63029860-63029882 AGGGAGGAAGAGAACAAGCCCGG - Intergenic
1176648330 21:9371440-9371462 GGGGAGGGACAGAGTGAGCCAGG - Intergenic
1177010408 21:15725165-15725187 GAGGAGAAAGAGAAATAGCCTGG + Intergenic
1177329824 21:19643645-19643667 GTGGGGAGAGAGAATTAGCCAGG - Intergenic
1177347709 21:19895108-19895130 GGGGAGCAAGAGAGAGAGCGGGG + Intergenic
1178147309 21:29755176-29755198 GAGGAGAAAGAAAGTGTGCCTGG + Intronic
1178898693 21:36582213-36582235 AGGTAGAGAGAGAATAAGCCTGG + Intergenic
1178941766 21:36912684-36912706 AGGGAGAGAGAGAAGGAGTCAGG + Intronic
1179262086 21:39766200-39766222 AAGGAGAAAGAGAATGAAGCAGG - Intronic
1179727787 21:43350100-43350122 GGGGAGGAAGAGAATTACCTTGG - Intergenic
1179902405 21:44401012-44401034 GAGGAGAAAGGGAAGGAGGCAGG - Intronic
1179935884 21:44603058-44603080 GTGGAGACAGAGAAGGAGGCTGG + Intronic
1179947322 21:44687104-44687126 GGGAAGAAGGAGGCTGAGCCTGG + Intronic
1180689011 22:17695112-17695134 GGCAAGAAAGAGAAAGAGACTGG + Intronic
1181747153 22:24963418-24963440 GGGGAGAATGAGAATCTGCTGGG + Intronic
1182011325 22:27003163-27003185 GGGAAGATAGAGAAAGAGACAGG - Intergenic
1182012121 22:27009875-27009897 GTGGAGAAAGAGCAGAAGCCAGG + Intergenic
1182015934 22:27039680-27039702 GAGAGGAAAGAGGATGAGCCCGG + Intergenic
1182085287 22:27557007-27557029 GGAGAGAAAGAGAATGGGCCAGG + Intergenic
1182168456 22:28201617-28201639 GGTGAGAAAGAAAATGAGAGAGG + Intronic
1182746110 22:32606659-32606681 GGGGAGAAAGCCACTGAGCCTGG - Intronic
1183493177 22:38127508-38127530 GGGGAGAGAGAGGTGGAGCCAGG + Intronic
1183594684 22:38803556-38803578 AGAGAGAAAGAGAAAGAGGCCGG - Intergenic
1184099993 22:42336953-42336975 GGGGAGACAGACAGTGAGCAAGG - Intronic
1184449764 22:44575977-44575999 GGGGAGAAAGAGGAGGAGGAGGG + Intergenic
1184602689 22:45552894-45552916 GGGGATAAAGAGGATGTGTCCGG - Intronic
1184913294 22:47550260-47550282 GGAAGGAAAGAGAAGGAGCCGGG - Intergenic
949879707 3:8651797-8651819 GGGGAGAAAGAGAATTAGGGTGG - Intronic
949984694 3:9531469-9531491 GGGGAGAGAGGGAAGGAGGCAGG + Intronic
950092407 3:10305167-10305189 GGACAGAAAGAGAATCAGCAGGG + Intronic
950221430 3:11199433-11199455 GGGGAGAATGGGCATTAGCCAGG - Intronic
950284263 3:11732480-11732502 GGGGAGAGAGATCATTAGCCAGG + Intergenic
950475267 3:13210803-13210825 GGGGAGAAGGGGAAGGAGGCAGG + Intergenic
950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG + Intergenic
950499620 3:13355351-13355373 GGAGAGAAAGGGAATGTGGCAGG - Intronic
950551967 3:13671580-13671602 GGGGATGCAGAGAGTGAGCCTGG - Intergenic
950670182 3:14521262-14521284 GGGGAGTGAGGGAATGAGCGAGG - Intronic
950914219 3:16627254-16627276 GCAGAAAAAGAGAAAGAGCCTGG + Intronic
951615395 3:24537897-24537919 GGAAAGAAAGAGAATGAGGGAGG + Intergenic
952205612 3:31179151-31179173 GGGGAGAAATAGAATGGGGAAGG - Intergenic
952235145 3:31471632-31471654 AGCCAGAAACAGAATGAGCCAGG + Intergenic
952334578 3:32392852-32392874 GGGGAACAAGAGAATCGGCCAGG - Intronic
952500171 3:33954276-33954298 GAGGAGAAAGAGATTGGGGCAGG + Intergenic
953076225 3:39572959-39572981 AGGCAGAAAGAGAAAGAGCCTGG - Intergenic
953341411 3:42137254-42137276 GGGAAGAAACAGAAATAGCCTGG - Intronic
954584601 3:51722359-51722381 GGGGAGGAAGAGAAAGAATCAGG - Intergenic
955058122 3:55474116-55474138 AGGGAGAAAGAAAGTGAGACGGG + Intronic
955228580 3:57079799-57079821 GGTGAGAATGAGGACGAGCCTGG + Intergenic
955266820 3:57452065-57452087 AGGCAGAAAGAGACTGAGGCAGG - Intronic
955631620 3:60981261-60981283 GGGGAGAAGGAGAAAAGGCCTGG - Intronic
957495882 3:80990937-80990959 GGAGAGAAAGAGAGTGAGGGGGG + Intergenic
957816990 3:85313410-85313432 GGGGAGAAAAGCAATGAGTCTGG - Intronic
958462033 3:94410562-94410584 GGGTAGAAAGAGAATGGCTCTGG + Intergenic
958467871 3:94480799-94480821 GGGGAGGCAGGAAATGAGCCAGG - Intergenic
959563162 3:107805677-107805699 GAGCAGAAACAGAATGATCCTGG + Exonic
959628258 3:108478591-108478613 GGGAAGAAATACAATGTGCCTGG + Intronic
960214265 3:115011200-115011222 GAGGAGGAAGAGAAAGAGACAGG + Intronic
960348383 3:116563381-116563403 GGGGAGAAAGAGAAAGAAAGAGG - Intronic
960515347 3:118596594-118596616 GGAGTGAAAGAGAATTACCCTGG + Intergenic
960639192 3:119810470-119810492 GGGGACAAAAAGAATGATGCAGG - Intronic
961788195 3:129360055-129360077 GGGGAGAAGGGGAAGGAGGCAGG - Intergenic
961818237 3:129562096-129562118 GGGTACAAAGAGAAGGTGCCAGG + Intronic
962312466 3:134336364-134336386 GGCTAGAAGGAGGATGAGCCAGG - Intergenic
963781659 3:149492569-149492591 GGGGAAGCAGAGGATGAGCCAGG + Intronic
964671390 3:159229812-159229834 GGGGAGAAGGAGGAGGAGCGGGG - Intronic
965416889 3:168407311-168407333 GGGGAAAATGAGAATGACCGGGG - Intergenic
965425381 3:168516454-168516476 GGAGAAAAAGAGAAGGAGCCAGG - Intergenic
966043372 3:175519327-175519349 GGGGAGAATGGGACTGAGACAGG + Intronic
966191352 3:177274326-177274348 GGGGAAGCAGAGAAGGAGCCTGG - Intergenic
966212212 3:177465073-177465095 GGGGAGCAAGGAAATGTGCCAGG - Intergenic
966431930 3:179841054-179841076 GGGGAGACAGAAAAGGAGACTGG + Intronic
967961464 3:194928632-194928654 GGGGAGTCAGGGAATGAGGCAGG + Intergenic
968447621 4:660274-660296 GGGGAGAGTGAGGCTGAGCCAGG + Intronic
969108854 4:4828818-4828840 GGAGAGAAAGAGAATGAGGAGGG - Intergenic
969278028 4:6150107-6150129 GGGAAGAAAGTGAATGATACAGG + Intronic
969282074 4:6177502-6177524 AGGGTGTAAGAGAAAGAGCCTGG + Intronic
969291241 4:6241469-6241491 GGGGAGATAGACAATGACTCCGG + Intergenic
969530513 4:7727853-7727875 TGGGAGAAAGAGAAGAAGACAGG + Intronic
969535788 4:7755428-7755450 GGGCAGAGAGAGCAGGAGCCGGG - Intergenic
970531424 4:16989396-16989418 GGAGAGAGAGAGAATGAGAGAGG - Intergenic
970542510 4:17094209-17094231 TGGGAGAGAGAGAAGGAGCAAGG + Intergenic
971484540 4:27145961-27145983 AGGGAAAAAGAGACTGAGGCTGG - Intergenic
971574091 4:28251884-28251906 GTGGAGAAAGAGAAGGAAGCTGG + Intergenic
972801191 4:42477485-42477507 GGGGAGAGAGAGAAAGAGAGGGG - Intronic
972903208 4:43711088-43711110 AGGGAGGAAGAGAAGGAGTCAGG - Intergenic
973190674 4:47381739-47381761 GGGGGGAAAGAGAAATAGACAGG - Intronic
973318887 4:48789840-48789862 GAGGAAAGAGAGAATAAGCCTGG - Intergenic
974099863 4:57404837-57404859 GTGGAGAAAGGGAATGAGAAGGG + Intergenic
975231484 4:71939399-71939421 GGGGAGATAGAGAAAGAGGAAGG - Intergenic
975602738 4:76119671-76119693 GGAAAGAAAGAGAAGCAGCCTGG - Intronic
975920182 4:79377699-79377721 GGAGAGAAAGAGAAGGAGGGAGG - Intergenic
977125190 4:93156555-93156577 GGTGAAAGAGAGAATAAGCCTGG + Intronic
977895287 4:102357689-102357711 GGGGAGAGAGAGAGTGAGCAGGG + Intronic
978105721 4:104899831-104899853 GTGGACAAAGAAAAAGAGCCTGG - Intergenic
979119382 4:116876473-116876495 AGTGAGAAAGAGAATGAGGGGGG - Intergenic
979143928 4:117216374-117216396 GGAGAGAGAGAGAGTGAGCAGGG - Intergenic
979555922 4:122047505-122047527 AAGGAGCAAGAGAATGAGACAGG + Intergenic
979609482 4:122674079-122674101 GGGGAGAATGAAAAAGAGCAGGG - Intergenic
979733054 4:124048037-124048059 GGGCAGAAAGAGAATGAAAATGG - Intergenic
981110810 4:140931078-140931100 GGGGAGAGAGAGAAGGGGCGGGG + Intronic
982173654 4:152684808-152684830 GGGGAGACAGAGACACAGCCAGG - Intergenic
982432539 4:155338943-155338965 GGAGAGAAAGAGAGAGAGCAGGG - Intergenic
982690065 4:158538516-158538538 GGGGAGAAAGAATAGGGGCCAGG + Intronic
982996013 4:162346676-162346698 CTGGAGAAAGATCATGAGCCCGG + Intergenic
983082679 4:163406392-163406414 GGGCACAAAGAGAAAGAGCCTGG + Intergenic
983207676 4:164927953-164927975 GGGGAAAGAGAGTATGTGCCTGG + Intergenic
983398458 4:167233743-167233765 GGGGAGGAAGAGTGTGAACCTGG + Intronic
983576941 4:169270739-169270761 GGGGAGAGAGAGACCGACCCAGG + Intronic
983712145 4:170731448-170731470 GGAGAAAAAGACAATGAACCTGG - Intergenic
983903047 4:173157067-173157089 GGATAGAAAGAGAAAGAACCTGG + Intergenic
984194198 4:176639050-176639072 TGGGAGTAAGAGAATGAGATAGG + Intergenic
984241548 4:177225874-177225896 GGGCAGAATGAGAGTGAGACAGG - Intergenic
984979715 4:185267993-185268015 GAGGAGGAAGAGAATGAGGAGGG + Intronic
985041380 4:185894916-185894938 GGGGAGCCAGTGACTGAGCCGGG + Intronic
985054006 4:186020320-186020342 TGGCTGAAGGAGAATGAGCCAGG + Intergenic
985361501 4:189180049-189180071 GGGGAGAATGAGACTGAGATAGG + Intergenic
985470559 5:41474-41496 GGAGGGAAAGAGAATATGCCTGG + Intergenic
985537765 5:474288-474310 GGAGAGAGAGAGAGCGAGCCAGG + Intronic
985537810 5:474491-474513 GGAGAGAGAGAGAGCGAGCCAGG + Intronic
985537856 5:474689-474711 GGGGAGAGAGAGAGCGAGCCAGG + Intronic
986171698 5:5319654-5319676 GGGGAGGAGGAGGAGGAGCCTGG - Exonic
986304559 5:6505786-6505808 GGAGAGAAAGGTAATGAACCTGG - Intergenic
986364305 5:7015757-7015779 GGGAGGAATGAGGATGAGCCAGG + Intergenic
986463090 5:7993275-7993297 GGGGAGAAAGAGAGAGAGTGAGG + Intergenic
987707085 5:21471334-21471356 TGGGAGAAATGGAATGAGGCTGG + Intergenic
988142771 5:27264602-27264624 GGGGAGAAAGAGAATCAAGGGGG - Intergenic
989016934 5:36947387-36947409 GGGGAGAAAGAGACAGAGGATGG - Intronic
989105703 5:37861404-37861426 AGGGAGAGAGAGAAAGAGCGGGG - Intergenic
989535225 5:42555802-42555824 GAAGAGAAAGACAAGGAGCCTGG + Intronic
990513631 5:56512349-56512371 AGAGGGAAAGAGAATGAGCCTGG + Intronic
990703236 5:58498001-58498023 GAGGAAATAGAGAAAGAGCCTGG - Intergenic
990715376 5:58630659-58630681 TGGGAGAAAGACAATGAGAAAGG + Intronic
992250561 5:74871729-74871751 GGGGAGAGAGAGAGGGAGCAAGG + Intergenic
992795834 5:80254680-80254702 AGAGAGAAAGAGAATGAGAATGG - Intronic
995864479 5:116676700-116676722 GGAGAAAAAGAGAAGGAGGCTGG - Intergenic
996010238 5:118474307-118474329 AAAGGGAAAGAGAATGAGCCTGG - Intergenic
996148106 5:119999919-119999941 AGGGAGAAAGAGAGAGAGGCAGG + Intergenic
996383403 5:122885265-122885287 GGGAACACAGAGAATGAGCTTGG - Intronic
996486831 5:124045109-124045131 GGGGAAAAAGAGAGTGAAACTGG + Intergenic
996629600 5:125611646-125611668 GGGGAGAAAGAGAGGGAGGTAGG + Intergenic
996629607 5:125611668-125611690 GGGGAGAAAGAGAGGGAGGTAGG + Intergenic
997817361 5:137032363-137032385 CAGGACAATGAGAATGAGCCTGG + Intronic
997828523 5:137129228-137129250 GGGGAAGAAGAGAAGGAGCTCGG - Intronic
997987315 5:138512828-138512850 GGGGACAAAGTGAATGTGGCTGG - Exonic
998426145 5:142030380-142030402 GGAGAGAAAGGGAAGGACCCAGG + Intergenic
998775599 5:145597604-145597626 GGTGAGAAAGAGAAAGTGGCAGG - Intronic
999507892 5:152217360-152217382 TGGGAGAAAGAGGGTGAGCCAGG + Intergenic
999627687 5:153537422-153537444 GGGGAGAGAGAGGGAGAGCCAGG - Intronic
1000152169 5:158513964-158513986 AGGGAGAAAGAGAAGGAGAGAGG + Intergenic
1000292449 5:159883149-159883171 GGGGAAAAAGAGAAGGAGCAAGG - Intergenic
1000335833 5:160240731-160240753 GGGGAGAGAGAGAAAGAGGAAGG + Intergenic
1000452174 5:161403067-161403089 GGAGAGAAAGAGAACCAGTCTGG - Intronic
1000590826 5:163155268-163155290 GGGGAGAAAGAGAAATAACAAGG + Intergenic
1001040728 5:168333244-168333266 GAGGAGAAAGGGAAAGAGGCGGG - Intronic
1001316934 5:170649939-170649961 GGTAAGTAAGAGAAAGAGCCAGG + Intronic
1001559782 5:172661453-172661475 TGGAAGAAAGGGCATGAGCCTGG + Intronic
1001748044 5:174107288-174107310 GGGAAGAAAGAGACAGAGTCAGG - Intronic
1001976684 5:176006145-176006167 GGGGGTAAAGAGAATGAGACAGG + Intronic
1002240743 5:177837636-177837658 AGGGGTAAAGAGAATGAGACAGG - Intergenic
1002454336 5:179337769-179337791 GGTGAGTAAGGGAATCAGCCAGG - Intronic
1003404041 6:5814048-5814070 GGGGAGAGAGAGAGAGAGACAGG + Intergenic
1003427398 6:6006888-6006910 GGAGAGAAAGAGAGGGAGCGAGG + Exonic
1003709612 6:8574845-8574867 AGGGAGAAAGAGAAAGAGAAAGG - Intergenic
1003891828 6:10570567-10570589 GGCTAGAAAGAAAATGAACCAGG - Intronic
1003968654 6:11277898-11277920 AGGAAGAAAGAGAATGAATCTGG - Intronic
1004078597 6:12368705-12368727 GGGAAGAGAGACAATGAGGCAGG + Intergenic
1004151028 6:13120248-13120270 GGGGAGGAAGAGAAGGAGAGAGG - Intronic
1004168096 6:13274468-13274490 GGAGAGAAAGATAAACAGCCAGG + Intronic
1004321523 6:14635174-14635196 GTGGAGAGAGAGAATGAGAGAGG - Intergenic
1004349250 6:14876840-14876862 GGGGAGACAGAGAAAGAAGCTGG - Intergenic
1004520874 6:16359413-16359435 GGGCAGAGAGAGAATGGGACTGG + Intronic
1004725623 6:18308803-18308825 GGGAAGAAAGAGAAGGAGAGAGG - Intergenic
1004726492 6:18316058-18316080 GGGGAGAAAGAGACAGAGGGAGG - Intergenic
1004937571 6:20522787-20522809 GAGAAGAAAGAAAATCAGCCAGG - Intergenic
1005197842 6:23309867-23309889 GGAGAGACAGAAAGTGAGCCAGG + Intergenic
1005235158 6:23752679-23752701 ATGGAAAAAGACAATGAGCCTGG - Intergenic
1006233123 6:32602535-32602557 GGGGAGAAGGAGTAGGAGCTGGG + Intergenic
1006285728 6:33092503-33092525 GGGGAGCAGGAGGATGGGCCTGG - Intergenic
1006968422 6:38014092-38014114 GGAGAGAGAGAGAATGAGAATGG + Intronic
1007085883 6:39144920-39144942 GTGGTGGAAGAGAAGGAGCCAGG - Intergenic
1007261744 6:40568880-40568902 GGGGAGATACAAAATTAGCCGGG - Intronic
1007284040 6:40735128-40735150 GGGAAGAAAGAAAATAAGACAGG + Intergenic
1007414267 6:41682966-41682988 GGAGAGAAGGAAAATGGGCCGGG - Intergenic
1007423792 6:41734689-41734711 GGGGAGAAAGAGACTGCCCAGGG + Intronic
1007494782 6:42252340-42252362 GGGGAGAAAGACAAAGACACAGG - Intronic
1007843411 6:44735089-44735111 GGGCAGTAAGAGAAAGAGCATGG - Intergenic
1008565565 6:52764665-52764687 GAGGAGAGTGAGGATGAGCCAGG + Intergenic
1008569750 6:52805003-52805025 GAGGAGAGTGAGGATGAGCCAGG + Intergenic
1009021139 6:57949174-57949196 TGGGAGAAATGGAATGAGGCTGG - Intergenic
1009249572 6:61281325-61281347 GGTGAAAAAGAGAATAACCCAGG - Intergenic
1010180888 6:73085490-73085512 GGGGAGAAAGTTATTGAGGCTGG + Intronic
1010389173 6:75317794-75317816 GAGCACACAGAGAATGAGCCTGG - Intronic
1011406787 6:87023569-87023591 GGGGAAAATGAAAATGATCCTGG + Intergenic
1011553486 6:88550874-88550896 GGGAAAAAAGAGCATAAGCCAGG + Intergenic
1011708498 6:90027250-90027272 TGGGAGAAAAAGAATGTGCTTGG + Intronic
1011986573 6:93454754-93454776 GGGCAGAAAGAGAATGAACTTGG + Intergenic
1012002948 6:93677271-93677293 GGGAAGAAAGAGCCTGAGCTTGG - Intergenic
1012491215 6:99784239-99784261 GGGAAAAAAGAGCAGGAGCCAGG + Intergenic
1012955649 6:105566963-105566985 GCAGAGAGAGAGAAAGAGCCAGG - Intergenic
1013386075 6:109632574-109632596 GGGGAGAGTGAGAGTGAGCCAGG + Intronic
1014797991 6:125748161-125748183 GGGGAGAGCGGGAAGGAGCCCGG - Intronic
1014918378 6:127182086-127182108 GGAGAGAGAGAGAAGGTGCCAGG + Intronic
1015018991 6:128449018-128449040 GGGGAAAAAAAAAATTAGCCAGG - Intronic
1015063357 6:128995642-128995664 GGGGAGAGAGAGAAGGAGAAAGG - Intronic
1015153486 6:130064529-130064551 GGAAAGGAAGAGAATAAGCCAGG + Intronic
1015199809 6:130566537-130566559 GAGGAGAAAGAGCAAGAGCAAGG + Intergenic
1015245119 6:131066104-131066126 AGGGAGAGAGAGAAAGAGTCTGG - Intergenic
1017038226 6:150286246-150286268 GGGGAGAGAGAGCATGCACCAGG + Intergenic
1017339551 6:153305136-153305158 GAGGAGGAAGAGGAGGAGCCAGG - Intergenic
1017450102 6:154547347-154547369 GGGTAGAAAAAGAATGAACTGGG + Intergenic
1017605799 6:156131471-156131493 GCAGAGAAAGAGAAAGAGCTTGG - Intergenic
1017630619 6:156392987-156393009 GGAGAGAGAGAGAGTGAGCATGG - Intergenic
1018078704 6:160239949-160239971 GGGAAGAAAAGGAATGAGCAGGG + Intronic
1018699757 6:166416982-166417004 GGGCTGAAAGAGAAGGAGTCAGG - Intronic
1018787450 6:167119138-167119160 GGGGACAAACAGCATGAGCCTGG - Intergenic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1019328514 7:451571-451593 GGAGAGAAAGAGAGAGAGACAGG - Intergenic
1019448639 7:1084528-1084550 GGGGGAGAAGCGAATGAGCCAGG + Intronic
1019843023 7:3468392-3468414 GGGGAGAATGCGACTGAGACAGG - Intronic
1020078317 7:5273267-5273289 GGGGAGAAAGACAGGGAGACAGG - Intergenic
1020190027 7:5988450-5988472 AGGGAGAATGAGAATGAGGCAGG + Intronic
1020292895 7:6736225-6736247 AGGGAGAATGAGAATGAGGCAGG - Intergenic
1020461713 7:8435139-8435161 GGAGAGAGAGAGATTGAGCGAGG - Intronic
1021290974 7:18845291-18845313 GGGGAGAGAGAGGGTGAGTCTGG + Intronic
1021949811 7:25763682-25763704 GTGGAGAAAGAGGAAGAGCTAGG - Intergenic
1022091557 7:27110980-27111002 GGGGAGAAGGAGAATGAGTGAGG + Intronic
1022425803 7:30267545-30267567 GGGGAGAAGGAGACTGAACCAGG + Intergenic
1022510554 7:30932614-30932636 AGGGAGAAAGAGAAGGAGAGAGG + Intergenic
1022523255 7:31021185-31021207 GGAGAGAGAGGGAATGAACCTGG - Intergenic
1022578832 7:31527141-31527163 GGGGAGAAGGAGGATGATTCAGG - Intronic
1022599325 7:31742118-31742140 ATGAAGAAAGAGAATGAGACTGG + Intergenic
1023281750 7:38577769-38577791 GGAGAGAAAGAGAAGGAGGAAGG + Intronic
1024233103 7:47377767-47377789 GGGGAGAAGGAGAAGGAGGGAGG - Intronic
1024269921 7:47634667-47634689 GGGGAGAAAGAGAGAGGGCGGGG + Intergenic
1024566837 7:50688405-50688427 AGGGAGAAAGAGAAACATCCAGG + Intronic
1025200580 7:56958926-56958948 GGGCAGAAAGAGAGGGAGACAGG + Intergenic
1025223142 7:57133283-57133305 GTGGAAAAAGAGAAAGAACCGGG - Intronic
1025671364 7:63618006-63618028 GGGCAGAAAGAGAGGGAGACAGG - Intergenic
1026188052 7:68099129-68099151 GGGGAGAGAGAGAATAAACAAGG - Intergenic
1026471865 7:70700585-70700607 GGGGAGAAAGAGATTAAGGGGGG + Intronic
1027163431 7:75818478-75818500 AGGTAAAAAGAGAAAGAGCCAGG + Intronic
1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG + Intronic
1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG + Intergenic
1027470487 7:78567617-78567639 GGGGAGAGAGAGAAGGAAGCTGG - Intronic
1027740071 7:81990420-81990442 GGAGAGAGTGACAATGAGCCAGG + Intronic
1027923568 7:84429833-84429855 TGGGAGGAAGAAAATGAGGCAGG + Intronic
1028087171 7:86650497-86650519 GTGGAGAAAGATCTTGAGCCTGG - Intronic
1028132096 7:87187431-87187453 GGGGAGCAAGAGCCTGAGGCAGG + Intronic
1028207691 7:88035097-88035119 AAGGAGCAAGAGAATGAGGCAGG - Intronic
1028994473 7:97085159-97085181 GGAGAGAAAGAGAGTGAGGGGGG + Intergenic
1029612856 7:101636612-101636634 GAGGAGAGAGAGGATGAGCTGGG + Intergenic
1029664152 7:101983679-101983701 GGGGAGAGAGAGAGTGAGAAGGG + Intronic
1031067557 7:117121843-117121865 GGTGACAAAGAGACTGAGCTAGG + Intronic
1031801442 7:126251679-126251701 GGGAAGGAAGGGAGTGAGCCAGG - Intergenic
1031843472 7:126775712-126775734 GGGGAGAGAGAGGATCAGTCAGG + Intronic
1032311008 7:130787113-130787135 AGGGAGAGAGAGAAGGTGCCAGG - Intergenic
1032372252 7:131368548-131368570 GGAGAGAAAGAGAATGAGTGGGG + Intronic
1032512405 7:132482278-132482300 GGCGAGAAAGAGGCTGAGCAAGG - Intronic
1032709367 7:134448799-134448821 GGAAAGAAAGAGTTTGAGCCTGG - Intronic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033600658 7:142886127-142886149 GGGGAGGCAGAGAGTGAGGCAGG - Intergenic
1033997505 7:147369309-147369331 GGGGAGACAGAGAATGAGTTTGG - Intronic
1034274287 7:149817299-149817321 GGGCAGAAAGAGCTTCAGCCAGG - Intergenic
1034474841 7:151276228-151276250 GTGGAGACAGAGAAGGTGCCAGG + Intronic
1034507254 7:151502808-151502830 GGGGACAAAGTGAATGTGGCTGG + Intronic
1034569357 7:151942682-151942704 GGGGAGAAAGAAAAGGAGAAAGG + Intergenic
1035675581 8:1453268-1453290 GGGGAGAAGCAGGAGGAGCCTGG + Intergenic
1035724914 8:1818280-1818302 GGGGAGCGAGACACTGAGCCCGG - Intergenic
1035962619 8:4154520-4154542 GTGGAGAAAGAGCAGAAGCCAGG + Intronic
1035971872 8:4258294-4258316 AGGGAGAAAGAGAGTGAGGGAGG + Intronic
1036123592 8:6043859-6043881 GGGGAGAGAGAGAAAGAGGGAGG - Intergenic
1036787833 8:11699549-11699571 GGGGAGGGAGAGAGGGAGCCAGG + Intronic
1036916649 8:12810753-12810775 GGGGAGAAAGAGGAGGAGGTAGG - Intergenic
1037433298 8:18837049-18837071 GGAGAGAAAGGGACTGAGCTAGG + Intronic
1037730692 8:21521115-21521137 AGGGAAACAGAGAATGAGACAGG + Intergenic
1038147523 8:24912953-24912975 GGGGACAAAGAGAACAGGCCGGG - Intergenic
1039067157 8:33618751-33618773 AGAGAGAGAGAGAATGAGCTAGG - Intergenic
1039111276 8:34043050-34043072 GAGGAGGAGGAGAATGTGCCAGG + Intergenic
1039118293 8:34116852-34116874 GAGGAGAAAGAGAATCAGGGAGG + Intergenic
1039446710 8:37638941-37638963 TGGTAGAAAGATAATGAGCCTGG + Intergenic
1039615532 8:38952178-38952200 GGGCAGGAAGGGAGTGAGCCCGG + Exonic
1040061039 8:43102975-43102997 GGGGTGAAAGAGACTGAGGCTGG - Intronic
1040125172 8:43728912-43728934 GGGGAAAAACAGAATGTCCCCGG + Intergenic
1040828227 8:51646858-51646880 GGAGAGAAAGGAAATGATCCAGG + Intronic
1041123903 8:54615158-54615180 GGGGAGAAAGAGAAAGAGTGAGG - Intergenic
1041245138 8:55881642-55881664 GGGGAGAGAAAGTAGGAGCCAGG + Intronic
1041342758 8:56863419-56863441 GGGGAAAAAGAGAAGGAGGAGGG + Intergenic
1041579347 8:59439425-59439447 CGGGAGGAAGAGAGAGAGCCGGG - Intergenic
1041964423 8:63658515-63658537 GTGGAGAAAGAGAATGTTCTAGG + Intergenic
1042015367 8:64303343-64303365 GGAGAGAGAGAGAATGAGAGAGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1043264070 8:78240358-78240380 GGGAAGAAAGAGAAAGAGAGAGG + Intergenic
1043562992 8:81516694-81516716 AGGCAGAGAGAAAATGAGCCTGG - Intergenic
1043588324 8:81795310-81795332 GGGGAGGAAGAGAAATACCCAGG - Intergenic
1043729834 8:83662778-83662800 GTGTAGAAAGAGAATGAGACGGG + Intergenic
1043774358 8:84246204-84246226 GGAAAGAGAGAGAATGAGGCAGG - Intronic
1044049283 8:87479830-87479852 GGAGAGAAAGAGAAATGGCCTGG - Intronic
1044489293 8:92793142-92793164 GGGAAGACAGAGAAAGAGGCTGG - Intergenic
1044691559 8:94885142-94885164 TTGGAGAAAGAGATTTAGCCAGG + Exonic
1045184183 8:99819237-99819259 GGGAAGAAAGAGGAAAAGCCAGG + Intronic
1045342796 8:101269387-101269409 GGGGAGGAAAAGAAAGATCCTGG - Intergenic
1045937414 8:107697039-107697061 AGGGAAAAGGAGAATGAACCAGG + Intergenic
1045988739 8:108281393-108281415 GGAGAGAAAGAGAGAGAGACAGG - Intronic
1046784609 8:118252655-118252677 TGGGAGAAAGAGAAAGAGGAAGG - Intronic
1047039038 8:120972198-120972220 GGAAAGAAAAAAAATGAGCCAGG - Intergenic
1047923242 8:129656858-129656880 GGAGAGAAAGAGAGTGAAGCGGG + Intergenic
1048363078 8:133714964-133714986 GGGGAAAATGAGACTGAGTCTGG + Intergenic
1048602556 8:135933461-135933483 AGGGATAAAGAGAATGAGTTTGG + Intergenic
1049235140 8:141508465-141508487 AGGGACACAGAGAAGGAGCCTGG - Intergenic
1049856780 8:144867146-144867168 TGGCAGAGAGAGAGTGAGCCAGG + Intergenic
1050084527 9:1950655-1950677 AGGGAAAGAGAGAATGAGACAGG + Intergenic
1051473410 9:17475509-17475531 GGGGAGAGAGGGAATGAACAGGG + Intronic
1051895861 9:21988603-21988625 GAGGAGAAAGGGAATGAGCGAGG + Intronic
1052709526 9:32036652-32036674 GAGGAGACACAGAATGAGACAGG + Intergenic
1052968072 9:34356988-34357010 GGGGAGAAAGAGGAAGAGAAGGG + Intergenic
1053001539 9:34579420-34579442 GGAGAGACAGAGATTGAGACAGG + Intronic
1053003805 9:34591570-34591592 TGGCAGAAAGAGGCTGAGCCAGG - Intergenic
1053043491 9:34894077-34894099 GGGAATAAAGAGAATAAGACAGG + Intergenic
1053417520 9:37956059-37956081 GGGGAGAGAGAGAAAGTGCAGGG + Intronic
1053444376 9:38140431-38140453 GGAGAAAAATAGAAAGAGCCAGG - Intergenic
1054999282 9:71430027-71430049 AGGGAGATAGAGAATGAGAGGGG - Intronic
1055476525 9:76668598-76668620 GAGGAGTGAGAGAATGATCCAGG - Intronic
1056112287 9:83407923-83407945 GGAGAGAAAGAGAAAGAGAAAGG - Intronic
1056130419 9:83580615-83580637 GGGGATCAAGAGAATGAACGGGG + Intergenic
1056148327 9:83757934-83757956 GGAGAGGAAGATGATGAGCCTGG + Intronic
1057705130 9:97390465-97390487 GGGAGGAGGGAGAATGAGCCAGG + Intergenic
1057826048 9:98372554-98372576 GGGGAAAAAGAGAGGCAGCCAGG + Intronic
1057950883 9:99368347-99368369 GGGGAGAGAGAGAAGGAGAGAGG + Intergenic
1058455045 9:105130870-105130892 GGGCAAAAAAAGAATGAGGCTGG + Intergenic
1058637086 9:107047725-107047747 GGGGAGAGACAGAATGAGGCCGG - Intergenic
1058773369 9:108260625-108260647 GGGGAGAAAGTGACTGACACTGG - Intergenic
1058792806 9:108468256-108468278 GGGGAGTGAGTGAAGGAGCCTGG - Intergenic
1058969470 9:110067052-110067074 GGGAAGATAGAGAATGAGGAAGG + Intronic
1059189490 9:112310909-112310931 TGGCTGAAAGAGAATGAGCAAGG + Intronic
1059322169 9:113478230-113478252 GGGGAGGAAGAGAAAGAGCAGGG - Intronic
1059423999 9:114209559-114209581 AGGGAGGAAGAGGAGGAGCCGGG + Intronic
1059671151 9:116493652-116493674 GGGGAGAAAGAGAGAGAGAGGGG - Intronic
1060294195 9:122332245-122332267 GGGGAGAGGGAGGGTGAGCCAGG + Intergenic
1060958080 9:127658693-127658715 GGGGAAAACTAGAATGATCCAGG - Intronic
1061176130 9:128998449-128998471 GGGAAGAAAGGCAATGAGGCCGG + Intronic
1061307484 9:129740427-129740449 GGGGAAAAGGAGACAGAGCCCGG - Intronic
1061412937 9:130430952-130430974 GGGGTGAAGGAGAATGTTCCAGG + Intronic
1061453012 9:130678699-130678721 GGGGAGAGAGAGAATGAGAGAGG + Intronic
1061889662 9:133611385-133611407 AGGCAGAAAGAGAGAGAGCCAGG + Intergenic
1062130623 9:134891135-134891157 TGGGGGGAAGCGAATGAGCCAGG - Intergenic
1062744633 9:138203510-138203532 GGGGAGAAGGAGGAGGAGTCGGG + Intergenic
1185535735 X:860329-860351 ATGGATAAAGAAAATGAGCCGGG - Intergenic
1186683504 X:11900404-11900426 GGGGAAGAAGAGAAGGAGCATGG + Intergenic
1186829940 X:13379956-13379978 GGGGAGAATGGGACTGAGACAGG + Intergenic
1187414250 X:19078894-19078916 GGGGAGAAAAAGAGAGAGGCAGG + Intronic
1187634271 X:21210076-21210098 CAGGAGAAAGAGAATGAGGGCGG - Intergenic
1188278252 X:28228671-28228693 AGGGAGCAAGAGAGCGAGCCAGG - Intergenic
1188529850 X:31127839-31127861 GGGAAGAAAGAGAAGGAGAGAGG - Intronic
1188649682 X:32616622-32616644 GGGAATATAGAAAATGAGCCTGG - Intronic
1188800890 X:34528158-34528180 GGAGAGAAAGAGAATGAAGGGGG - Intergenic
1188930052 X:36097904-36097926 GAGGAGGTAGAGAAAGAGCCGGG - Intronic
1190229854 X:48573937-48573959 GAGGAGAAAGAGTAGGAGTCAGG + Intergenic
1190735766 X:53255243-53255265 AGGAAGAAAGAGAATGAGAAAGG + Intronic
1190774776 X:53543970-53543992 TGGGAGAAAGAGAAAGAGGAAGG + Intronic
1190937887 X:55013039-55013061 GAGGAGAATGAGAAGCAGCCAGG - Intronic
1191263328 X:58353859-58353881 GGGGAAAAAGTGAATAACCCGGG + Intergenic
1191268874 X:58435624-58435646 GGGGAGAAAGAAAATATCCCAGG - Intergenic
1191915931 X:66201178-66201200 GGGTAGAAAGAGAAAGAGAGAGG - Intronic
1192174986 X:68879888-68879910 GGGGAGAAAGTGAATGGGTGAGG - Intergenic
1192177155 X:68893251-68893273 GAGCAGAAAGGGCATGAGCCAGG - Intergenic
1192268238 X:69555318-69555340 GGGGATATAGAGAATGTGGCTGG + Intergenic
1192533647 X:71910810-71910832 GGGGAGGAGGAGGAGGAGCCCGG + Intergenic
1193215481 X:78858559-78858581 AGGGAGAGAGAGAATGAACGGGG - Intergenic
1193444778 X:81587440-81587462 GGTAAGGAAGAAAATGAGCCTGG - Intergenic
1194276828 X:91895351-91895373 TGGGAAAAAGAGATTGAGACAGG + Intronic
1195030408 X:100922132-100922154 GGAGAGAAAGAAAAGGAGCGTGG - Intronic
1195349761 X:103985150-103985172 GGGGAGGAAGAGGAAGAGGCAGG - Intergenic
1195357682 X:104053689-104053711 GGGGAGGAAGAGGAAGAGGCAGG + Intergenic
1195823462 X:108971486-108971508 TGGGGGAAAGAGCATGAGCGGGG + Intergenic
1198058595 X:133020803-133020825 GGGGAGAATGGGACTGAGACAGG + Intergenic
1198116531 X:133549921-133549943 GGAGAGAAAGAGAAAGAGAAAGG - Intronic
1198620151 X:138499079-138499101 GGAGAGAAAGAGAAAGAGGTGGG + Intergenic
1198804551 X:140481140-140481162 GGGGAAGAAGAGAAGGAGCATGG - Intergenic
1199372619 X:147069074-147069096 GGTGAGAGAGAGAATGAGAGAGG - Intergenic
1199881940 X:151980816-151980838 TGGGAAGAAGAGAAGGAGCCAGG + Intergenic
1200001742 X:153065649-153065671 GGGCAGAAAGAGCAGGAGCAGGG + Intergenic
1200205432 X:154312181-154312203 AGGGAGAATGAGAATAAGGCTGG - Intronic
1200594178 Y:5117462-5117484 TGGGAAAAAGAGATTGAGACAGG + Intronic
1201304017 Y:12535307-12535329 GGGGAGAAAAAGAAAAAGCTAGG - Intergenic
1201458931 Y:14201342-14201364 GGGGAGGAAGAGAAGGAGTAAGG + Intergenic
1201613167 Y:15865750-15865772 TTGGAGAATGAGAATGAGCTTGG - Intergenic